FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632161_at:

>probe:Drosophila_2:1632161_at:32:445; Interrogation_Position=1999; Antisense; GATGACTCCACGGATGGCTTGTTTA
>probe:Drosophila_2:1632161_at:81:571; Interrogation_Position=2014; Antisense; GGCTTGTTTAACTTCAACTCTGAAA
>probe:Drosophila_2:1632161_at:439:35; Interrogation_Position=2048; Antisense; ATCATGATGACGAGGATTCCCGGTT
>probe:Drosophila_2:1632161_at:689:353; Interrogation_Position=2128; Antisense; GCACCGCGTAGAGATAGACCCAAGA
>probe:Drosophila_2:1632161_at:374:467; Interrogation_Position=2168; Antisense; GTTGGTTATCGTGTAGCAGGCTAAA
>probe:Drosophila_2:1632161_at:427:201; Interrogation_Position=2238; Antisense; AACCTCTATTAAGGCGGATCCCGAT
>probe:Drosophila_2:1632161_at:700:399; Interrogation_Position=2290; Antisense; GACAGCATTGAGGTGCGCATGTGCA
>probe:Drosophila_2:1632161_at:36:709; Interrogation_Position=2317; Antisense; TTAAACATTGTCATTCGCTCCCAGG
>probe:Drosophila_2:1632161_at:535:445; Interrogation_Position=2350; Antisense; GATGCTTCTCTTGAGGATTCTGTGA
>probe:Drosophila_2:1632161_at:555:715; Interrogation_Position=2367; Antisense; TTCTGTGAACAAGCATGGCGGCCGC
>probe:Drosophila_2:1632161_at:65:47; Interrogation_Position=2423; Antisense; ATCCTCATCCCCAAAAGCGAATTGT
>probe:Drosophila_2:1632161_at:237:5; Interrogation_Position=2443; Antisense; ATTGTTGCGCTTAAGAGTCTTCGGC
>probe:Drosophila_2:1632161_at:143:203; Interrogation_Position=2484; Antisense; AACCTGTGTTTAATGTCGTGCCTAA
>probe:Drosophila_2:1632161_at:404:131; Interrogation_Position=2518; Antisense; ACCGTCGCTTGTGAAGTTACTTTAT

Paste this into a BLAST search page for me
GATGACTCCACGGATGGCTTGTTTAGGCTTGTTTAACTTCAACTCTGAAAATCATGATGACGAGGATTCCCGGTTGCACCGCGTAGAGATAGACCCAAGAGTTGGTTATCGTGTAGCAGGCTAAAAACCTCTATTAAGGCGGATCCCGATGACAGCATTGAGGTGCGCATGTGCATTAAACATTGTCATTCGCTCCCAGGGATGCTTCTCTTGAGGATTCTGTGATTCTGTGAACAAGCATGGCGGCCGCATCCTCATCCCCAAAAGCGAATTGTATTGTTGCGCTTAAGAGTCTTCGGCAACCTGTGTTTAATGTCGTGCCTAAACCGTCGCTTGTGAAGTTACTTTAT

Full Affymetrix probeset data:

Annotations for 1632161_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720