Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632163_at:

>probe:Drosophila_2:1632163_at:43:173; Interrogation_Position=1021; Antisense; AAAGCTTTTGATTCCATTACACCGA
>probe:Drosophila_2:1632163_at:427:657; Interrogation_Position=1046; Antisense; TAAGCAACCATTCATTCACCAAGCG
>probe:Drosophila_2:1632163_at:505:261; Interrogation_Position=1062; Antisense; CACCAAGCGCTTGTGTTGATTTTTA
>probe:Drosophila_2:1632163_at:236:53; Interrogation_Position=1134; Antisense; ATGACAAAAGTGATCCGGGCTGTTC
>probe:Drosophila_2:1632163_at:487:303; Interrogation_Position=1148; Antisense; CCGGGCTGTTCGGTACATCTATAAG
>probe:Drosophila_2:1632163_at:444:517; Interrogation_Position=1232; Antisense; GTGTGTGCATAATTGCTCCTAGACA
>probe:Drosophila_2:1632163_at:166:249; Interrogation_Position=1255; Antisense; CAAAAATCTACCTGCAATCTACCTG
>probe:Drosophila_2:1632163_at:457:377; Interrogation_Position=1304; Antisense; GAAGCTCAAGTATCTTCCAACGAAA
>probe:Drosophila_2:1632163_at:672:241; Interrogation_Position=1336; Antisense; AATAGACATATCGAGCCTTAGCATT
>probe:Drosophila_2:1632163_at:723:671; Interrogation_Position=848; Antisense; TACCCAGCCCGATCAGAGAGTGGCA
>probe:Drosophila_2:1632163_at:235:697; Interrogation_Position=907; Antisense; TTTACGGGTTTTACCTGCCAGCAGC
>probe:Drosophila_2:1632163_at:151:335; Interrogation_Position=930; Antisense; GCTGCTTCGAGCCATAACCTGTGGA
>probe:Drosophila_2:1632163_at:436:267; Interrogation_Position=958; Antisense; CAGGCAGTCTGCCAAGTGCATGTGT
>probe:Drosophila_2:1632163_at:211:317; Interrogation_Position=987; Antisense; GCCTCGTTGCTCTGGCAATTTGCAA

Paste this into a BLAST search page for me
AAAGCTTTTGATTCCATTACACCGATAAGCAACCATTCATTCACCAAGCGCACCAAGCGCTTGTGTTGATTTTTAATGACAAAAGTGATCCGGGCTGTTCCCGGGCTGTTCGGTACATCTATAAGGTGTGTGCATAATTGCTCCTAGACACAAAAATCTACCTGCAATCTACCTGGAAGCTCAAGTATCTTCCAACGAAAAATAGACATATCGAGCCTTAGCATTTACCCAGCCCGATCAGAGAGTGGCATTTACGGGTTTTACCTGCCAGCAGCGCTGCTTCGAGCCATAACCTGTGGACAGGCAGTCTGCCAAGTGCATGTGTGCCTCGTTGCTCTGGCAATTTGCAA

Full Affymetrix probeset data:

Annotations for 1632163_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime