Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632165_at:

>probe:Drosophila_2:1632165_at:450:129; Interrogation_Position=1156; Antisense; ACCTTTGATGATTTATTCCGTGAGA
>probe:Drosophila_2:1632165_at:183:115; Interrogation_Position=1201; Antisense; AGCTTTGACGCTGAGGTACTACACA
>probe:Drosophila_2:1632165_at:390:437; Interrogation_Position=1288; Antisense; GAGGAGGTCTTCAAGCATCGCAAGA
>probe:Drosophila_2:1632165_at:613:415; Interrogation_Position=1311; Antisense; GAGCCTAAATACCAGTTATGCCTAT
>probe:Drosophila_2:1632165_at:623:379; Interrogation_Position=1336; Antisense; GAAGCCTATGAGGATCGCATTGCAT
>probe:Drosophila_2:1632165_at:283:45; Interrogation_Position=1349; Antisense; ATCGCATTGCATTCGAGCTGTCTCA
>probe:Drosophila_2:1632165_at:677:119; Interrogation_Position=1364; Antisense; AGCTGTCTCAGCAAAGGTATCTTCG
>probe:Drosophila_2:1632165_at:394:539; Interrogation_Position=1379; Antisense; GGTATCTTCGAGTGCCCATTTTCAA
>probe:Drosophila_2:1632165_at:233:213; Interrogation_Position=1428; Antisense; AAGACCTGTATTTGTGGCACTTCGA
>probe:Drosophila_2:1632165_at:658:555; Interrogation_Position=1443; Antisense; GGCACTTCGACATGGATTACCGTAT
>probe:Drosophila_2:1632165_at:23:673; Interrogation_Position=1486; Antisense; TACCTTAGGCGAATCTTTGAATCTG
>probe:Drosophila_2:1632165_at:9:209; Interrogation_Position=1522; Antisense; AAGCTCCAGGAAGACTCTTTTCTCG
>probe:Drosophila_2:1632165_at:252:79; Interrogation_Position=1613; Antisense; AGGATTTTTATTTCTTTGCGTACAT
>probe:Drosophila_2:1632165_at:563:441; Interrogation_Position=1652; Antisense; GATGGTGTGTCAGCACTATAGCTTT

Paste this into a BLAST search page for me
ACCTTTGATGATTTATTCCGTGAGAAGCTTTGACGCTGAGGTACTACACAGAGGAGGTCTTCAAGCATCGCAAGAGAGCCTAAATACCAGTTATGCCTATGAAGCCTATGAGGATCGCATTGCATATCGCATTGCATTCGAGCTGTCTCAAGCTGTCTCAGCAAAGGTATCTTCGGGTATCTTCGAGTGCCCATTTTCAAAAGACCTGTATTTGTGGCACTTCGAGGCACTTCGACATGGATTACCGTATTACCTTAGGCGAATCTTTGAATCTGAAGCTCCAGGAAGACTCTTTTCTCGAGGATTTTTATTTCTTTGCGTACATGATGGTGTGTCAGCACTATAGCTTT

Full Affymetrix probeset data:

Annotations for 1632165_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime