FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632166_at:

>probe:Drosophila_2:1632166_at:342:379; Interrogation_Position=2149; Antisense; GAAGCCATCTTCAGTGTCCTGAACA
>probe:Drosophila_2:1632166_at:598:385; Interrogation_Position=2169; Antisense; GAACAACAGTCACAACTTCCTGGCG
>probe:Drosophila_2:1632166_at:262:583; Interrogation_Position=2189; Antisense; TGGCGACCGTTATCCCTCAATTGAG
>probe:Drosophila_2:1632166_at:439:565; Interrogation_Position=2282; Antisense; GGCAAAATGTGATGTCCCGTCTGGC
>probe:Drosophila_2:1632166_at:449:97; Interrogation_Position=2309; Antisense; AGATCATCGATCTCGTGGGAGCCAT
>probe:Drosophila_2:1632166_at:39:523; Interrogation_Position=2365; Antisense; GTGGCCACCTTCTATTTGAACCTCA
>probe:Drosophila_2:1632166_at:229:633; Interrogation_Position=2395; Antisense; TCCCAGACTCTGGACGTGGCGAAGT
>probe:Drosophila_2:1632166_at:415:61; Interrogation_Position=2432; Antisense; ATGTGGTCACCTCCGGTATTGTGGA
>probe:Drosophila_2:1632166_at:719:221; Interrogation_Position=2473; Antisense; AAGGACTTGGAAGCGTGCTACCGTT
>probe:Drosophila_2:1632166_at:656:147; Interrogation_Position=2527; Antisense; ACTTCGTGCGGCCAAGAGACCATTG
>probe:Drosophila_2:1632166_at:155:81; Interrogation_Position=2590; Antisense; AGGGAACTTACCATTACTCCGCAGG
>probe:Drosophila_2:1632166_at:554:77; Interrogation_Position=2630; Antisense; AGGTGAATTCTGTGGGCCAGGCCCT
>probe:Drosophila_2:1632166_at:526:577; Interrogation_Position=2649; Antisense; GGCCCTGCTGGCTGTGTTCTAAGAT
>probe:Drosophila_2:1632166_at:152:513; Interrogation_Position=2662; Antisense; GTGTTCTAAGATCTCCGCCAAGCAA

Paste this into a BLAST search page for me
GAAGCCATCTTCAGTGTCCTGAACAGAACAACAGTCACAACTTCCTGGCGTGGCGACCGTTATCCCTCAATTGAGGGCAAAATGTGATGTCCCGTCTGGCAGATCATCGATCTCGTGGGAGCCATGTGGCCACCTTCTATTTGAACCTCATCCCAGACTCTGGACGTGGCGAAGTATGTGGTCACCTCCGGTATTGTGGAAAGGACTTGGAAGCGTGCTACCGTTACTTCGTGCGGCCAAGAGACCATTGAGGGAACTTACCATTACTCCGCAGGAGGTGAATTCTGTGGGCCAGGCCCTGGCCCTGCTGGCTGTGTTCTAAGATGTGTTCTAAGATCTCCGCCAAGCAA

Full Affymetrix probeset data:

Annotations for 1632166_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720