FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632168_at:

>probe:Drosophila_2:1632168_at:170:563; Interrogation_Position=100; Antisense; GGAAGATCCGGCAAATCTGCCAGCT
>probe:Drosophila_2:1632168_at:48:239; Interrogation_Position=113; Antisense; AATCTGCCAGCTCCAGAGGCAGCAG
>probe:Drosophila_2:1632168_at:315:673; Interrogation_Position=25; Antisense; TACCATACTCGCCATGAACTTCATA
>probe:Drosophila_2:1632168_at:290:599; Interrogation_Position=259; Antisense; TGTCAATCACAACGTCATAACCATT
>probe:Drosophila_2:1632168_at:242:371; Interrogation_Position=303; Antisense; GAAGGAGGCCACAATCTTGATTTAA
>probe:Drosophila_2:1632168_at:569:705; Interrogation_Position=324; Antisense; TTAAGAACCCATTGGTACACCCATA
>probe:Drosophila_2:1632168_at:168:591; Interrogation_Position=336; Antisense; TGGTACACCCATATTACACGCACTG
>probe:Drosophila_2:1632168_at:505:163; Interrogation_Position=368; Antisense; AAATTATTTTCATTTGCGTCGCAAT
>probe:Drosophila_2:1632168_at:167:329; Interrogation_Position=383; Antisense; GCGTCGCAATGTGAGGTATTTATTT
>probe:Drosophila_2:1632168_at:365:613; Interrogation_Position=39; Antisense; TGAACTTCATACAGATCGCCGTGCT
>probe:Drosophila_2:1632168_at:339:477; Interrogation_Position=428; Antisense; GTTTACTGCTTGTTGTAGAACTCGC
>probe:Drosophila_2:1632168_at:606:723; Interrogation_Position=440; Antisense; TTGTAGAACTCGCAGAACATCATCT
>probe:Drosophila_2:1632168_at:366:151; Interrogation_Position=456; Antisense; ACATCATCTCTCTGACACGGATTTT
>probe:Drosophila_2:1632168_at:476:577; Interrogation_Position=82; Antisense; GGCCTTGGCCAGACCACAGGAAGAT

Paste this into a BLAST search page for me
GGAAGATCCGGCAAATCTGCCAGCTAATCTGCCAGCTCCAGAGGCAGCAGTACCATACTCGCCATGAACTTCATATGTCAATCACAACGTCATAACCATTGAAGGAGGCCACAATCTTGATTTAATTAAGAACCCATTGGTACACCCATATGGTACACCCATATTACACGCACTGAAATTATTTTCATTTGCGTCGCAATGCGTCGCAATGTGAGGTATTTATTTTGAACTTCATACAGATCGCCGTGCTGTTTACTGCTTGTTGTAGAACTCGCTTGTAGAACTCGCAGAACATCATCTACATCATCTCTCTGACACGGATTTTGGCCTTGGCCAGACCACAGGAAGAT

Full Affymetrix probeset data:

Annotations for 1632168_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720