Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632170_a_at:

>probe:Drosophila_2:1632170_a_at:238:401; Interrogation_Position=2860; Antisense; GACATGTCTCAGTTTCGAATGCATT
>probe:Drosophila_2:1632170_a_at:403:59; Interrogation_Position=2981; Antisense; ATGATTCAGCTCACAAGCCACGAAC
>probe:Drosophila_2:1632170_a_at:377:407; Interrogation_Position=3012; Antisense; GACGGCATCTGCACCAACAAAACGA
>probe:Drosophila_2:1632170_a_at:35:3; Interrogation_Position=3050; Antisense; ATTCTTTATCCGAGGTGTTTGCTAA
>probe:Drosophila_2:1632170_a_at:363:5; Interrogation_Position=3084; Antisense; ATTGATACAGCCCATCCCAAAGATG
>probe:Drosophila_2:1632170_a_at:68:173; Interrogation_Position=3102; Antisense; AAAGATGTGGCCTACTCCTTCTGAT
>probe:Drosophila_2:1632170_a_at:47:531; Interrogation_Position=3136; Antisense; GGGATATCTTCGATGGGCTCATCAT
>probe:Drosophila_2:1632170_a_at:380:125; Interrogation_Position=3171; Antisense; AGCCCGCCTGAAGTAGTAGCCGTGT
>probe:Drosophila_2:1632170_a_at:465:485; Interrogation_Position=3186; Antisense; GTAGCCGTGTTTCGTCTTAAATGTG
>probe:Drosophila_2:1632170_a_at:550:95; Interrogation_Position=3227; Antisense; AGATAAGATTCCTTGCGTCCTGACC
>probe:Drosophila_2:1632170_a_at:383:679; Interrogation_Position=3255; Antisense; TAGTAGAGTCTAGTTTGTGTGCCCC
>probe:Drosophila_2:1632170_a_at:55:71; Interrogation_Position=3315; Antisense; AGGCCGAGAGATCAATGCGCTTTCC
>probe:Drosophila_2:1632170_a_at:40:697; Interrogation_Position=3335; Antisense; TTTCCCATGCGGTACAACAAGATCA
>probe:Drosophila_2:1632170_a_at:283:473; Interrogation_Position=3380; Antisense; GTTCTTGCCAGATTATTTACCCGCA

Paste this into a BLAST search page for me
GACATGTCTCAGTTTCGAATGCATTATGATTCAGCTCACAAGCCACGAACGACGGCATCTGCACCAACAAAACGAATTCTTTATCCGAGGTGTTTGCTAAATTGATACAGCCCATCCCAAAGATGAAAGATGTGGCCTACTCCTTCTGATGGGATATCTTCGATGGGCTCATCATAGCCCGCCTGAAGTAGTAGCCGTGTGTAGCCGTGTTTCGTCTTAAATGTGAGATAAGATTCCTTGCGTCCTGACCTAGTAGAGTCTAGTTTGTGTGCCCCAGGCCGAGAGATCAATGCGCTTTCCTTTCCCATGCGGTACAACAAGATCAGTTCTTGCCAGATTATTTACCCGCA

Full Affymetrix probeset data:

Annotations for 1632170_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime