Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632171_a_at:

>probe:Drosophila_2:1632171_a_at:265:43; Interrogation_Position=109; Antisense; ATCGCTAACAGCCATGTCGGTAATA
>probe:Drosophila_2:1632171_a_at:57:705; Interrogation_Position=134; Antisense; TTATATTTCGAACTCTGGTCACACA
>probe:Drosophila_2:1632171_a_at:728:589; Interrogation_Position=149; Antisense; TGGTCACACAGCCATACAGCTTGAG
>probe:Drosophila_2:1632171_a_at:142:653; Interrogation_Position=245; Antisense; TAATAGCGTAATTTTGGCCCAAGAG
>probe:Drosophila_2:1632171_a_at:384:477; Interrogation_Position=28; Antisense; GTATTTTTGCCAGAGTTGCCGACTT
>probe:Drosophila_2:1632171_a_at:463:165; Interrogation_Position=284; Antisense; AAATGATCTGATGGCCTACACAAAC
>probe:Drosophila_2:1632171_a_at:427:525; Interrogation_Position=310; Antisense; GGGACAAAGCGCTCCTTGAATCGGG
>probe:Drosophila_2:1632171_a_at:543:439; Interrogation_Position=338; Antisense; GAGGCGTACCTCAAACCTGCAGGCG
>probe:Drosophila_2:1632171_a_at:119:349; Interrogation_Position=356; Antisense; GCAGGCGCCCATAATGCAATTAGAA
>probe:Drosophila_2:1632171_a_at:725:427; Interrogation_Position=393; Antisense; GAGATTTTCACAGCGGAATTCCATC
>probe:Drosophila_2:1632171_a_at:62:551; Interrogation_Position=425; Antisense; GGAGTTATTGCTTTCTTCTGGGTTC
>probe:Drosophila_2:1632171_a_at:719:341; Interrogation_Position=434; Antisense; GCTTTCTTCTGGGTTCGATAGGCAA
>probe:Drosophila_2:1632171_a_at:654:707; Interrogation_Position=52; Antisense; TTCACTTCCTTTGTTCTCACTGAAA
>probe:Drosophila_2:1632171_a_at:338:393; Interrogation_Position=73; Antisense; GAAAGTAGCCACATCTATTCAGAAA

Paste this into a BLAST search page for me
ATCGCTAACAGCCATGTCGGTAATATTATATTTCGAACTCTGGTCACACATGGTCACACAGCCATACAGCTTGAGTAATAGCGTAATTTTGGCCCAAGAGGTATTTTTGCCAGAGTTGCCGACTTAAATGATCTGATGGCCTACACAAACGGGACAAAGCGCTCCTTGAATCGGGGAGGCGTACCTCAAACCTGCAGGCGGCAGGCGCCCATAATGCAATTAGAAGAGATTTTCACAGCGGAATTCCATCGGAGTTATTGCTTTCTTCTGGGTTCGCTTTCTTCTGGGTTCGATAGGCAATTCACTTCCTTTGTTCTCACTGAAAGAAAGTAGCCACATCTATTCAGAAA

Full Affymetrix probeset data:

Annotations for 1632171_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime