FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632176_at:

>probe:Drosophila_2:1632176_at:166:167; Interrogation_Position=1033; Antisense; AAATCCGCAGTTCCAATGAGTAGTT
>probe:Drosophila_2:1632176_at:4:415; Interrogation_Position=1077; Antisense; GAGCCATAATTTTCGCGGTACTTGC
>probe:Drosophila_2:1632176_at:45:539; Interrogation_Position=1093; Antisense; GGTACTTGCCTCTTGGATTGCAAAT
>probe:Drosophila_2:1632176_at:239:129; Interrogation_Position=584; Antisense; ACGCCCAAATTCGATGCGGTTTACT
>probe:Drosophila_2:1632176_at:7:53; Interrogation_Position=597; Antisense; ATGCGGTTTACTTCTTCGATGAGAC
>probe:Drosophila_2:1632176_at:134:153; Interrogation_Position=626; Antisense; ACAGGTGTCTACATCTTGGCCAAGC
>probe:Drosophila_2:1632176_at:133:581; Interrogation_Position=643; Antisense; GGCCAAGCTCATCAATTGTGTGCAG
>probe:Drosophila_2:1632176_at:92:619; Interrogation_Position=680; Antisense; TGCATGGATGCCTGCCTGATGGAGA
>probe:Drosophila_2:1632176_at:566:607; Interrogation_Position=696; Antisense; TGATGGAGATTATGCCCCACTACTT
>probe:Drosophila_2:1632176_at:171:697; Interrogation_Position=754; Antisense; TTATCACTACGAGACCCTGGAACTT
>probe:Drosophila_2:1632176_at:188:521; Interrogation_Position=787; Antisense; GTGGAAGATCATCGTGTTCCCCTAC
>probe:Drosophila_2:1632176_at:713:267; Interrogation_Position=872; Antisense; CATACGGCCTGCTGTGAGGATCATT
>probe:Drosophila_2:1632176_at:346:259; Interrogation_Position=940; Antisense; CACTCCTGCTGGTAATTTCGACTTG
>probe:Drosophila_2:1632176_at:662:559; Interrogation_Position=983; Antisense; GGAAATCAGAACTTCCTCCGTCTGT

Paste this into a BLAST search page for me
AAATCCGCAGTTCCAATGAGTAGTTGAGCCATAATTTTCGCGGTACTTGCGGTACTTGCCTCTTGGATTGCAAATACGCCCAAATTCGATGCGGTTTACTATGCGGTTTACTTCTTCGATGAGACACAGGTGTCTACATCTTGGCCAAGCGGCCAAGCTCATCAATTGTGTGCAGTGCATGGATGCCTGCCTGATGGAGATGATGGAGATTATGCCCCACTACTTTTATCACTACGAGACCCTGGAACTTGTGGAAGATCATCGTGTTCCCCTACCATACGGCCTGCTGTGAGGATCATTCACTCCTGCTGGTAATTTCGACTTGGGAAATCAGAACTTCCTCCGTCTGT

Full Affymetrix probeset data:

Annotations for 1632176_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720