Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632177_at:

>probe:Drosophila_2:1632177_at:498:105; Interrogation_Position=2439; Antisense; AGAAACTTAGAGATCCCACGCTCTC
>probe:Drosophila_2:1632177_at:237:21; Interrogation_Position=2494; Antisense; ATATAGTTCTTAGTCAGGCCCCAAA
>probe:Drosophila_2:1632177_at:696:549; Interrogation_Position=2552; Antisense; GGAGTTGTATGCTAGGCGAACCCCT
>probe:Drosophila_2:1632177_at:241:323; Interrogation_Position=2567; Antisense; GCGAACCCCTAAGCTTGCAAGCGAA
>probe:Drosophila_2:1632177_at:52:165; Interrogation_Position=2606; Antisense; AAATCGTAAGCAGCAAACCCCTCTT
>probe:Drosophila_2:1632177_at:244:643; Interrogation_Position=2627; Antisense; TCTTCTAGCTACCAAAACCAACCAA
>probe:Drosophila_2:1632177_at:544:187; Interrogation_Position=2655; Antisense; AACACTTTCTACTGCTAATTTCTAC
>probe:Drosophila_2:1632177_at:19:167; Interrogation_Position=2726; Antisense; AAATGTACTTAAATCGAACTGCGAA
>probe:Drosophila_2:1632177_at:594:187; Interrogation_Position=2749; Antisense; AACAGTCGATCGCAGTTCTTCAGCT
>probe:Drosophila_2:1632177_at:384:473; Interrogation_Position=2763; Antisense; GTTCTTCAGCTATATGGGCAGTCAT
>probe:Drosophila_2:1632177_at:299:63; Interrogation_Position=2776; Antisense; ATGGGCAGTCATTTGTATACTTAGA
>probe:Drosophila_2:1632177_at:91:395; Interrogation_Position=2799; Antisense; GACTATAGTCGAACCGATTCCCAGC
>probe:Drosophila_2:1632177_at:247:463; Interrogation_Position=2814; Antisense; GATTCCCAGCGGTTTATTATAGCCA
>probe:Drosophila_2:1632177_at:596:453; Interrogation_Position=2956; Antisense; GTTGTACTTTGTCTCAAACCCAGAA

Paste this into a BLAST search page for me
AGAAACTTAGAGATCCCACGCTCTCATATAGTTCTTAGTCAGGCCCCAAAGGAGTTGTATGCTAGGCGAACCCCTGCGAACCCCTAAGCTTGCAAGCGAAAAATCGTAAGCAGCAAACCCCTCTTTCTTCTAGCTACCAAAACCAACCAAAACACTTTCTACTGCTAATTTCTACAAATGTACTTAAATCGAACTGCGAAAACAGTCGATCGCAGTTCTTCAGCTGTTCTTCAGCTATATGGGCAGTCATATGGGCAGTCATTTGTATACTTAGAGACTATAGTCGAACCGATTCCCAGCGATTCCCAGCGGTTTATTATAGCCAGTTGTACTTTGTCTCAAACCCAGAA

Full Affymetrix probeset data:

Annotations for 1632177_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime