FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632178_at:

>probe:Drosophila_2:1632178_at:301:379; Interrogation_Position=6647; Antisense; GAAGCGTTAACAGAAACTCCATCAA
>probe:Drosophila_2:1632178_at:366:391; Interrogation_Position=6659; Antisense; GAAACTCCATCAACCAAACGACAGA
>probe:Drosophila_2:1632178_at:75:307; Interrogation_Position=6698; Antisense; CCTCTGGACCCAAGGATACCCAAAT
>probe:Drosophila_2:1632178_at:236:25; Interrogation_Position=6713; Antisense; ATACCCAAATCTGCCGCCAGAATTG
>probe:Drosophila_2:1632178_at:539:523; Interrogation_Position=6738; Antisense; GGGCGAGTCTTATATCTAATTTTGT
>probe:Drosophila_2:1632178_at:14:567; Interrogation_Position=6765; Antisense; GGCAAAATTCGTGAAAAGCTCTTCG
>probe:Drosophila_2:1632178_at:220:205; Interrogation_Position=6780; Antisense; AAGCTCTTCGAAACAAGTCTCGACA
>probe:Drosophila_2:1632178_at:381:87; Interrogation_Position=6795; Antisense; AGTCTCGACACAGCCACTAAATCTG
>probe:Drosophila_2:1632178_at:386:459; Interrogation_Position=6929; Antisense; GATTTGAATTTTTGCCCTATTACGT
>probe:Drosophila_2:1632178_at:697:321; Interrogation_Position=6942; Antisense; GCCCTATTACGTTTATGTTCTTTCG
>probe:Drosophila_2:1632178_at:621:477; Interrogation_Position=6980; Antisense; GTTTATTTTTCTGTTCCTTAATGCA
>probe:Drosophila_2:1632178_at:403:661; Interrogation_Position=7018; Antisense; TAAAATTCGTTATTACTCGTAAGCA
>probe:Drosophila_2:1632178_at:586:439; Interrogation_Position=7078; Antisense; GATGGAGAAGTCAAGCAGCTATACA
>probe:Drosophila_2:1632178_at:500:13; Interrogation_Position=7122; Antisense; ATTAGCTTAGCGTGTAACTACATAT

Paste this into a BLAST search page for me
GAAGCGTTAACAGAAACTCCATCAAGAAACTCCATCAACCAAACGACAGACCTCTGGACCCAAGGATACCCAAATATACCCAAATCTGCCGCCAGAATTGGGGCGAGTCTTATATCTAATTTTGTGGCAAAATTCGTGAAAAGCTCTTCGAAGCTCTTCGAAACAAGTCTCGACAAGTCTCGACACAGCCACTAAATCTGGATTTGAATTTTTGCCCTATTACGTGCCCTATTACGTTTATGTTCTTTCGGTTTATTTTTCTGTTCCTTAATGCATAAAATTCGTTATTACTCGTAAGCAGATGGAGAAGTCAAGCAGCTATACAATTAGCTTAGCGTGTAACTACATAT

Full Affymetrix probeset data:

Annotations for 1632178_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720