FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632179_at:

>probe:Drosophila_2:1632179_at:448:49; Interrogation_Position=1115; Antisense; ATGCGCGTCTTCAAGGGAATCCCAA
>probe:Drosophila_2:1632179_at:36:519; Interrogation_Position=1145; Antisense; GTGGTTAATCTCAGCACCTTGGCAG
>probe:Drosophila_2:1632179_at:580:729; Interrogation_Position=1163; Antisense; TTGGCAGCCATTGCACCTATATCCT
>probe:Drosophila_2:1632179_at:300:687; Interrogation_Position=1180; Antisense; TATATCCTCGATGGCACACTATTGC
>probe:Drosophila_2:1632179_at:716:225; Interrogation_Position=1211; Antisense; AAGGCAGCCCGTGAGATGTACTTCC
>probe:Drosophila_2:1632179_at:529:99; Interrogation_Position=1224; Antisense; AGATGTACTTCCGAGTGCTGGCCAC
>probe:Drosophila_2:1632179_at:72:393; Interrogation_Position=1265; Antisense; GACACCCTGGTGTTGAACTACGCGC
>probe:Drosophila_2:1632179_at:510:321; Interrogation_Position=1288; Antisense; GCCCGGCGTCATAGACACACAGATG
>probe:Drosophila_2:1632179_at:420:99; Interrogation_Position=1308; Antisense; AGATGACCGTCCAGGTTCAGCGAGA
>probe:Drosophila_2:1632179_at:613:291; Interrogation_Position=1348; Antisense; CGTGGTCGCCATGTTTCGAGAGCAA
>probe:Drosophila_2:1632179_at:680:221; Interrogation_Position=1372; Antisense; AAGGGAGTCCAAGACCATGCTGACT
>probe:Drosophila_2:1632179_at:123:345; Interrogation_Position=1436; Antisense; GCATTCAAGTTCAAGTCCGGCGATC
>probe:Drosophila_2:1632179_at:96:341; Interrogation_Position=1579; Antisense; GCTACAACACCCAATACATCTTAAT
>probe:Drosophila_2:1632179_at:131:693; Interrogation_Position=1665; Antisense; TTTCCAACAACTCGGCATCTATTTA

Paste this into a BLAST search page for me
ATGCGCGTCTTCAAGGGAATCCCAAGTGGTTAATCTCAGCACCTTGGCAGTTGGCAGCCATTGCACCTATATCCTTATATCCTCGATGGCACACTATTGCAAGGCAGCCCGTGAGATGTACTTCCAGATGTACTTCCGAGTGCTGGCCACGACACCCTGGTGTTGAACTACGCGCGCCCGGCGTCATAGACACACAGATGAGATGACCGTCCAGGTTCAGCGAGACGTGGTCGCCATGTTTCGAGAGCAAAAGGGAGTCCAAGACCATGCTGACTGCATTCAAGTTCAAGTCCGGCGATCGCTACAACACCCAATACATCTTAATTTTCCAACAACTCGGCATCTATTTA

Full Affymetrix probeset data:

Annotations for 1632179_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720