FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632180_at:

>probe:Drosophila_2:1632180_at:562:381; Interrogation_Position=1688; Antisense; GAACCCATTTCCGAGGACATGCTAA
>probe:Drosophila_2:1632180_at:524:657; Interrogation_Position=1710; Antisense; TAAGACGCCTGTGTGCTTCCAAGAA
>probe:Drosophila_2:1632180_at:490:191; Interrogation_Position=1758; Antisense; AACTTCAGGTTTTCTACTCAGCGCT
>probe:Drosophila_2:1632180_at:53:243; Interrogation_Position=1791; Antisense; AATATCACGGAGCATCGGCGCGGCA
>probe:Drosophila_2:1632180_at:435:105; Interrogation_Position=1831; Antisense; AGACACCTTGCGCTCAGTACAGGAT
>probe:Drosophila_2:1632180_at:402:289; Interrogation_Position=1864; Antisense; CGGACTTCCCTACGTAGATAACACT
>probe:Drosophila_2:1632180_at:427:31; Interrogation_Position=1881; Antisense; ATAACACTGCGTGGCAACTGCGGTT
>probe:Drosophila_2:1632180_at:104:483; Interrogation_Position=1933; Antisense; GTATTATGCCTATCTTGTTTCGAAA
>probe:Drosophila_2:1632180_at:15:349; Interrogation_Position=1978; Antisense; GCAGACGTACTTTGAAGCCAACCCA
>probe:Drosophila_2:1632180_at:691:129; Interrogation_Position=1998; Antisense; ACCCATTCAATCGTCAGGCTGGTGA
>probe:Drosophila_2:1632180_at:370:75; Interrogation_Position=2053; Antisense; AGGAGCAGTTCCCAGCCGTAAGTTG
>probe:Drosophila_2:1632180_at:233:581; Interrogation_Position=2079; Antisense; TGGCCAACTTTCTGCAGCGCGAGAT
>probe:Drosophila_2:1632180_at:148:613; Interrogation_Position=2103; Antisense; TGACACCCAGTGTTTTGGCCGACAG
>probe:Drosophila_2:1632180_at:562:581; Interrogation_Position=2118; Antisense; TGGCCGACAGTCTTATCACAGAGAT

Paste this into a BLAST search page for me
GAACCCATTTCCGAGGACATGCTAATAAGACGCCTGTGTGCTTCCAAGAAAACTTCAGGTTTTCTACTCAGCGCTAATATCACGGAGCATCGGCGCGGCAAGACACCTTGCGCTCAGTACAGGATCGGACTTCCCTACGTAGATAACACTATAACACTGCGTGGCAACTGCGGTTGTATTATGCCTATCTTGTTTCGAAAGCAGACGTACTTTGAAGCCAACCCAACCCATTCAATCGTCAGGCTGGTGAAGGAGCAGTTCCCAGCCGTAAGTTGTGGCCAACTTTCTGCAGCGCGAGATTGACACCCAGTGTTTTGGCCGACAGTGGCCGACAGTCTTATCACAGAGAT

Full Affymetrix probeset data:

Annotations for 1632180_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720