FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632181_at:

>probe:Drosophila_2:1632181_at:52:27; Interrogation_Position=1022; Antisense; ATAGAGACCTCTGCCTAATAATTCG
>probe:Drosophila_2:1632181_at:193:185; Interrogation_Position=1038; Antisense; AATAATTCGGCGTGGCCAGGAGCCT
>probe:Drosophila_2:1632181_at:506:641; Interrogation_Position=1062; Antisense; TCTGATTATGAGAGCCAGCCCCTTT
>probe:Drosophila_2:1632181_at:11:715; Interrogation_Position=578; Antisense; TTCTGACTTGGCTTGTGTGCATTGA
>probe:Drosophila_2:1632181_at:720:73; Interrogation_Position=603; Antisense; AGGACTCTCTGTATCTATTTACGTG
>probe:Drosophila_2:1632181_at:163:693; Interrogation_Position=637; Antisense; TTTGCCATCGAAGTTCTATGCCTCG
>probe:Drosophila_2:1632181_at:420:383; Interrogation_Position=661; Antisense; GAACTGCGTCACCTTCATCAGAGGT
>probe:Drosophila_2:1632181_at:686:465; Interrogation_Position=707; Antisense; GATTGGAGACGAATCGCCTGGTCCA
>probe:Drosophila_2:1632181_at:487:317; Interrogation_Position=722; Antisense; GCCTGGTCCAGTTCCATCAGAAGAT
>probe:Drosophila_2:1632181_at:310:661; Interrogation_Position=810; Antisense; TAACTTTTTCCTGGTGTCCCTATCG
>probe:Drosophila_2:1632181_at:346:503; Interrogation_Position=825; Antisense; GTCCCTATCGGTTCTAGAGGCCATG
>probe:Drosophila_2:1632181_at:574:51; Interrogation_Position=895; Antisense; ATGCTGCTAGCCTTGGGACATCTAT
>probe:Drosophila_2:1632181_at:557:551; Interrogation_Position=937; Antisense; GGAGACCTGTTATCGCAGAAATCCT
>probe:Drosophila_2:1632181_at:112:343; Interrogation_Position=979; Antisense; GCTTATGAGGCGTATGATCCCATCA

Paste this into a BLAST search page for me
ATAGAGACCTCTGCCTAATAATTCGAATAATTCGGCGTGGCCAGGAGCCTTCTGATTATGAGAGCCAGCCCCTTTTTCTGACTTGGCTTGTGTGCATTGAAGGACTCTCTGTATCTATTTACGTGTTTGCCATCGAAGTTCTATGCCTCGGAACTGCGTCACCTTCATCAGAGGTGATTGGAGACGAATCGCCTGGTCCAGCCTGGTCCAGTTCCATCAGAAGATTAACTTTTTCCTGGTGTCCCTATCGGTCCCTATCGGTTCTAGAGGCCATGATGCTGCTAGCCTTGGGACATCTATGGAGACCTGTTATCGCAGAAATCCTGCTTATGAGGCGTATGATCCCATCA

Full Affymetrix probeset data:

Annotations for 1632181_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720