FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632182_at:

>probe:Drosophila_2:1632182_at:205:29; Interrogation_Position=1247; Antisense; ATACTAAGAAGCTATCGGCGCACAT
>probe:Drosophila_2:1632182_at:227:211; Interrogation_Position=1273; Antisense; AAGAAGAGGCTGCTCAACTCCCTGG
>probe:Drosophila_2:1632182_at:92:195; Interrogation_Position=1288; Antisense; AACTCCCTGGATGTGATTTATGACT
>probe:Drosophila_2:1632182_at:618:459; Interrogation_Position=1302; Antisense; GATTTATGACTTCAAGACGCCGCCT
>probe:Drosophila_2:1632182_at:662:177; Interrogation_Position=1353; Antisense; AAACTGGTACGAGTGCTTCGCTGGG
>probe:Drosophila_2:1632182_at:512:61; Interrogation_Position=1399; Antisense; ATGGACCTGATAAACACTCCGTTCC
>probe:Drosophila_2:1632182_at:412:69; Interrogation_Position=1435; Antisense; ATGGCCGCCTTGTCGTTCTTGAAAA
>probe:Drosophila_2:1632182_at:445:241; Interrogation_Position=1498; Antisense; AATACCGGCGGTGCTGTGGAGTTCC
>probe:Drosophila_2:1632182_at:461:587; Interrogation_Position=1514; Antisense; TGGAGTTCCTTCTTTCGCGTCAAAA
>probe:Drosophila_2:1632182_at:123:705; Interrogation_Position=1577; Antisense; TTATGGAGATTCTGTCCGCTAGCGC
>probe:Drosophila_2:1632182_at:91:577; Interrogation_Position=1635; Antisense; GGCCTATGTGAACGAGGGACCCTAT
>probe:Drosophila_2:1632182_at:348:331; Interrogation_Position=1669; Antisense; GCGGATCTCGATGTAGCCACTGAAC
>probe:Drosophila_2:1632182_at:499:67; Interrogation_Position=1719; Antisense; ATGGCAGGCATTTGCGGCCTTCGAT
>probe:Drosophila_2:1632182_at:716:577; Interrogation_Position=1734; Antisense; GGCCTTCGATTGCAAGTCCTATGTT

Paste this into a BLAST search page for me
ATACTAAGAAGCTATCGGCGCACATAAGAAGAGGCTGCTCAACTCCCTGGAACTCCCTGGATGTGATTTATGACTGATTTATGACTTCAAGACGCCGCCTAAACTGGTACGAGTGCTTCGCTGGGATGGACCTGATAAACACTCCGTTCCATGGCCGCCTTGTCGTTCTTGAAAAAATACCGGCGGTGCTGTGGAGTTCCTGGAGTTCCTTCTTTCGCGTCAAAATTATGGAGATTCTGTCCGCTAGCGCGGCCTATGTGAACGAGGGACCCTATGCGGATCTCGATGTAGCCACTGAACATGGCAGGCATTTGCGGCCTTCGATGGCCTTCGATTGCAAGTCCTATGTT

Full Affymetrix probeset data:

Annotations for 1632182_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720