Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632183_at:

>probe:Drosophila_2:1632183_at:404:581; Interrogation_Position=1227; Antisense; TGGCCCTGGGCGTATGGTGCATATT
>probe:Drosophila_2:1632183_at:704:591; Interrogation_Position=1241; Antisense; TGGTGCATATTCAGCGCCTTTGGAA
>probe:Drosophila_2:1632183_at:558:691; Interrogation_Position=1259; Antisense; TTTGGAATCGCCTTCAACTTGGTGA
>probe:Drosophila_2:1632183_at:469:241; Interrogation_Position=1283; Antisense; AATACGGTCACAGCTCAACTTCTGG
>probe:Drosophila_2:1632183_at:580:543; Interrogation_Position=1361; Antisense; GGATGATTCCCCAGACGGAAGCCAT
>probe:Drosophila_2:1632183_at:604:377; Interrogation_Position=1378; Antisense; GAAGCCATAGACTGCATCCCGTTCA
>probe:Drosophila_2:1632183_at:345:29; Interrogation_Position=1404; Antisense; ATACACTCACTCCTCTTAAATGTCT
>probe:Drosophila_2:1632183_at:301:707; Interrogation_Position=1419; Antisense; TTAAATGTCTCCTCTTATGCCCTAG
>probe:Drosophila_2:1632183_at:386:277; Interrogation_Position=1465; Antisense; CTTTTCCCAGGACAGTGTGCTCAAA
>probe:Drosophila_2:1632183_at:666:37; Interrogation_Position=1496; Antisense; ATCTATCGTCTATCGGATATCCTGG
>probe:Drosophila_2:1632183_at:167:707; Interrogation_Position=1556; Antisense; TTAGCTCGTAAGTCCCAACATTTAT
>probe:Drosophila_2:1632183_at:656:415; Interrogation_Position=1625; Antisense; GAGCCTGGCTCACATCAAAGACTAA
>probe:Drosophila_2:1632183_at:387:637; Interrogation_Position=1680; Antisense; TCGATTGTCCATTGAGTTGCCTACT
>probe:Drosophila_2:1632183_at:386:71; Interrogation_Position=1706; Antisense; AGGCTTAATGCCAAACCAGAGCTTA

Paste this into a BLAST search page for me
TGGCCCTGGGCGTATGGTGCATATTTGGTGCATATTCAGCGCCTTTGGAATTTGGAATCGCCTTCAACTTGGTGAAATACGGTCACAGCTCAACTTCTGGGGATGATTCCCCAGACGGAAGCCATGAAGCCATAGACTGCATCCCGTTCAATACACTCACTCCTCTTAAATGTCTTTAAATGTCTCCTCTTATGCCCTAGCTTTTCCCAGGACAGTGTGCTCAAAATCTATCGTCTATCGGATATCCTGGTTAGCTCGTAAGTCCCAACATTTATGAGCCTGGCTCACATCAAAGACTAATCGATTGTCCATTGAGTTGCCTACTAGGCTTAATGCCAAACCAGAGCTTA

Full Affymetrix probeset data:

Annotations for 1632183_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime