FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632184_at:

>probe:Drosophila_2:1632184_at:553:573; Interrogation_Position=1159; Antisense; GGCTGTGCTGATTTTATGCTGAATC
>probe:Drosophila_2:1632184_at:9:335; Interrogation_Position=1176; Antisense; GCTGAATCTTCTACAAAGTGGCGAA
>probe:Drosophila_2:1632184_at:447:81; Interrogation_Position=1192; Antisense; AGTGGCGAATCTGCCGAATTTCCAT
>probe:Drosophila_2:1632184_at:263:365; Interrogation_Position=1207; Antisense; GAATTTCCATTGTCCGTCTGTCCAT
>probe:Drosophila_2:1632184_at:636:499; Interrogation_Position=1222; Antisense; GTCTGTCCATCTAAATTGGGCCTCG
>probe:Drosophila_2:1632184_at:725:239; Interrogation_Position=1251; Antisense; AATAACACCCTTGGTATTGACGAAT
>probe:Drosophila_2:1632184_at:114:473; Interrogation_Position=1293; Antisense; GTTCACCATTGAAAACGTCGTCGAT
>probe:Drosophila_2:1632184_at:644:635; Interrogation_Position=1310; Antisense; TCGTCGATGTTTTTGTTGTTAATTC
>probe:Drosophila_2:1632184_at:589:245; Interrogation_Position=1374; Antisense; AATTCGTTACGAGAGTGCTGCAAGC
>probe:Drosophila_2:1632184_at:160:87; Interrogation_Position=1387; Antisense; AGTGCTGCAAGCTGTTTGACCCAAA
>probe:Drosophila_2:1632184_at:10:505; Interrogation_Position=1603; Antisense; GTCCTTTAGTGTGGTCTTGCGTGCA
>probe:Drosophila_2:1632184_at:719:497; Interrogation_Position=1616; Antisense; GTCTTGCGTGCATTATGGAATCCTT
>probe:Drosophila_2:1632184_at:622:475; Interrogation_Position=1683; Antisense; GTTAGATCTCTCTTTTGTTAGCACA
>probe:Drosophila_2:1632184_at:559:181; Interrogation_Position=1729; Antisense; AAAAAACATCCCCATGTTCTCACAA

Paste this into a BLAST search page for me
GGCTGTGCTGATTTTATGCTGAATCGCTGAATCTTCTACAAAGTGGCGAAAGTGGCGAATCTGCCGAATTTCCATGAATTTCCATTGTCCGTCTGTCCATGTCTGTCCATCTAAATTGGGCCTCGAATAACACCCTTGGTATTGACGAATGTTCACCATTGAAAACGTCGTCGATTCGTCGATGTTTTTGTTGTTAATTCAATTCGTTACGAGAGTGCTGCAAGCAGTGCTGCAAGCTGTTTGACCCAAAGTCCTTTAGTGTGGTCTTGCGTGCAGTCTTGCGTGCATTATGGAATCCTTGTTAGATCTCTCTTTTGTTAGCACAAAAAAACATCCCCATGTTCTCACAA

Full Affymetrix probeset data:

Annotations for 1632184_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720