Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632185_s_at:

>probe:Drosophila_2:1632185_s_at:92:577; Interrogation_Position=322; Antisense; GGCCTTGCTGAACGTAAAGACCTGT
>probe:Drosophila_2:1632185_s_at:299:377; Interrogation_Position=331; Antisense; GAACGTAAAGACCTGTGAGTCCCTG
>probe:Drosophila_2:1632185_s_at:627:297; Interrogation_Position=368; Antisense; CGCAGCACCGAGAGATTCGCCTACG
>probe:Drosophila_2:1632185_s_at:142:101; Interrogation_Position=378; Antisense; AGAGATTCGCCTACGCCGGCCAGAA
>probe:Drosophila_2:1632185_s_at:266:603; Interrogation_Position=411; Antisense; TGTTCCAGTACAGCGGAGCCGAGAC
>probe:Drosophila_2:1632185_s_at:233:107; Interrogation_Position=474; Antisense; AGAACTGGTTTGCTGAGCGCTCGAA
>probe:Drosophila_2:1632185_s_at:623:123; Interrogation_Position=489; Antisense; AGCGCTCGAATGCATCTCCCGAGAT
>probe:Drosophila_2:1632185_s_at:91:343; Interrogation_Position=522; Antisense; GCTTCCCGGAGGAGCTTCCCAACAA
>probe:Drosophila_2:1632185_s_at:53:513; Interrogation_Position=551; Antisense; GTGACCAAGTTCACCATCGCGGTGG
>probe:Drosophila_2:1632185_s_at:567:401; Interrogation_Position=623; Antisense; GACTTTTACAACCACTTCGTACTCA
>probe:Drosophila_2:1632185_s_at:693:357; Interrogation_Position=651; Antisense; GCAACTTCGCCACATCGAACATTGT
>probe:Drosophila_2:1632185_s_at:108:385; Interrogation_Position=667; Antisense; GAACATTGTGGGTCAGCCTGTCTAC
>probe:Drosophila_2:1632185_s_at:684:125; Interrogation_Position=681; Antisense; AGCCTGTCTACACTCCGGGAGAGAA
>probe:Drosophila_2:1632185_s_at:56:509; Interrogation_Position=760; Antisense; GTGCTACGCCAAGGAGATCTACGAC

Paste this into a BLAST search page for me
GGCCTTGCTGAACGTAAAGACCTGTGAACGTAAAGACCTGTGAGTCCCTGCGCAGCACCGAGAGATTCGCCTACGAGAGATTCGCCTACGCCGGCCAGAATGTTCCAGTACAGCGGAGCCGAGACAGAACTGGTTTGCTGAGCGCTCGAAAGCGCTCGAATGCATCTCCCGAGATGCTTCCCGGAGGAGCTTCCCAACAAGTGACCAAGTTCACCATCGCGGTGGGACTTTTACAACCACTTCGTACTCAGCAACTTCGCCACATCGAACATTGTGAACATTGTGGGTCAGCCTGTCTACAGCCTGTCTACACTCCGGGAGAGAAGTGCTACGCCAAGGAGATCTACGAC

Full Affymetrix probeset data:

Annotations for 1632185_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime