FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632187_at:

>probe:Drosophila_2:1632187_at:659:553; Interrogation_Position=2530; Antisense; GGAGCCGCCAAGATGGTTATCCTAA
>probe:Drosophila_2:1632187_at:403:213; Interrogation_Position=2597; Antisense; AAGAGCTGCCGGTCGTGGATTCGCC
>probe:Drosophila_2:1632187_at:448:221; Interrogation_Position=2647; Antisense; AAGTGTGTCAGCTTGCCTGTGGAGC
>probe:Drosophila_2:1632187_at:442:587; Interrogation_Position=2666; Antisense; TGGAGCCGGAGAGTCATCTGCTGCA
>probe:Drosophila_2:1632187_at:419:141; Interrogation_Position=2746; Antisense; ACGGAACTTACACCCATGCTGGATG
>probe:Drosophila_2:1632187_at:127:67; Interrogation_Position=2789; Antisense; AGGCCAATAGTGCTACTCTTCCGAG
>probe:Drosophila_2:1632187_at:152:253; Interrogation_Position=2838; Antisense; CAAGATGCTGCATTTGGTTCCCAAG
>probe:Drosophila_2:1632187_at:664:37; Interrogation_Position=2887; Antisense; ATCTACTATTGGTGCGATGTGCCCA
>probe:Drosophila_2:1632187_at:187:441; Interrogation_Position=2935; Antisense; GATGGCGCTTATAATCCCCTATGGA
>probe:Drosophila_2:1632187_at:469:65; Interrogation_Position=2955; Antisense; ATGGACCAGTCGAGGCTTTACGCAA
>probe:Drosophila_2:1632187_at:122:377; Interrogation_Position=3005; Antisense; GAAGACAGCAGTCAACGCCGCTAAA
>probe:Drosophila_2:1632187_at:145:25; Interrogation_Position=3042; Antisense; ATATGTGACACTGCCCTGGTGGAGC
>probe:Drosophila_2:1632187_at:479:449; Interrogation_Position=3076; Antisense; GATCTCTTGGATCACCGGGAAACGC
>probe:Drosophila_2:1632187_at:595:559; Interrogation_Position=3093; Antisense; GGAAACGCCTATTCTGACCTTTTAG

Paste this into a BLAST search page for me
GGAGCCGCCAAGATGGTTATCCTAAAAGAGCTGCCGGTCGTGGATTCGCCAAGTGTGTCAGCTTGCCTGTGGAGCTGGAGCCGGAGAGTCATCTGCTGCAACGGAACTTACACCCATGCTGGATGAGGCCAATAGTGCTACTCTTCCGAGCAAGATGCTGCATTTGGTTCCCAAGATCTACTATTGGTGCGATGTGCCCAGATGGCGCTTATAATCCCCTATGGAATGGACCAGTCGAGGCTTTACGCAAGAAGACAGCAGTCAACGCCGCTAAAATATGTGACACTGCCCTGGTGGAGCGATCTCTTGGATCACCGGGAAACGCGGAAACGCCTATTCTGACCTTTTAG

Full Affymetrix probeset data:

Annotations for 1632187_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720