FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632188_at:

>probe:Drosophila_2:1632188_at:229:515; Interrogation_Position=2047; Antisense; GTGTCCCATTGACGCGTACGATGCA
>probe:Drosophila_2:1632188_at:598:633; Interrogation_Position=2050; Antisense; TCCCATTGACGCGTACGATGCACAA
>probe:Drosophila_2:1632188_at:662:273; Interrogation_Position=2053; Antisense; CATTGACGCGTACGATGCACAAGTT
>probe:Drosophila_2:1632188_at:495:411; Interrogation_Position=2057; Antisense; GACGCGTACGATGCACAAGTTTGAC
>probe:Drosophila_2:1632188_at:62:489; Interrogation_Position=2062; Antisense; GTACGATGCACAAGTTTGACCAGCT
>probe:Drosophila_2:1632188_at:58:447; Interrogation_Position=2066; Antisense; GATGCACAAGTTTGACCAGCTATTA
>probe:Drosophila_2:1632188_at:38:415; Interrogation_Position=2079; Antisense; GACCAGCTATTAAACCATTTCTCTT
>probe:Drosophila_2:1632188_at:500:389; Interrogation_Position=2089; Antisense; TAAACCATTTCTCTTAACGGTCGCT
>probe:Drosophila_2:1632188_at:340:129; Interrogation_Position=2092; Antisense; ACCATTTCTCTTAACGGTCGCTATC
>probe:Drosophila_2:1632188_at:690:673; Interrogation_Position=2096; Antisense; TTTCTCTTAACGGTCGCTATCCTTG
>probe:Drosophila_2:1632188_at:543:643; Interrogation_Position=2100; Antisense; TCTTAACGGTCGCTATCCTTGTAGA
>probe:Drosophila_2:1632188_at:186:197; Interrogation_Position=2104; Antisense; AACGGTCGCTATCCTTGTAGATGTA
>probe:Drosophila_2:1632188_at:68:535; Interrogation_Position=2107; Antisense; GGTCGCTATCCTTGTAGATGTAGTC
>probe:Drosophila_2:1632188_at:322:297; Interrogation_Position=2110; Antisense; CGCTATCCTTGTAGATGTAGTCGGG

Paste this into a BLAST search page for me
GTGTCCCATTGACGCGTACGATGCATCCCATTGACGCGTACGATGCACAACATTGACGCGTACGATGCACAAGTTGACGCGTACGATGCACAAGTTTGACGTACGATGCACAAGTTTGACCAGCTGATGCACAAGTTTGACCAGCTATTAGACCAGCTATTAAACCATTTCTCTTTAAACCATTTCTCTTAACGGTCGCTACCATTTCTCTTAACGGTCGCTATCTTTCTCTTAACGGTCGCTATCCTTGTCTTAACGGTCGCTATCCTTGTAGAAACGGTCGCTATCCTTGTAGATGTAGGTCGCTATCCTTGTAGATGTAGTCCGCTATCCTTGTAGATGTAGTCGGG

Full Affymetrix probeset data:

Annotations for 1632188_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720