FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632189_at:

>probe:Drosophila_2:1632189_at:346:257; Interrogation_Position=1019; Antisense; CACTTGTTCGTGCAGTTCATCAATG
>probe:Drosophila_2:1632189_at:730:135; Interrogation_Position=1049; Antisense; ACGATCGGCTGCTAGCACTGTGATT
>probe:Drosophila_2:1632189_at:543:239; Interrogation_Position=1093; Antisense; AATAAAGTTCTTACCTCGGGCAGCA
>probe:Drosophila_2:1632189_at:648:59; Interrogation_Position=594; Antisense; ATGTTCCCTACACCAGAGAGACTTT
>probe:Drosophila_2:1632189_at:165:425; Interrogation_Position=611; Antisense; GAGACTTTTGATGCTCTGTGCCAGC
>probe:Drosophila_2:1632189_at:575:437; Interrogation_Position=641; Antisense; GAGGAGCCGCAGAGCAACAACCGTT
>probe:Drosophila_2:1632189_at:509:153; Interrogation_Position=669; Antisense; ACAGTCCGCTGGTGGTAGTCTTGCC
>probe:Drosophila_2:1632189_at:727:225; Interrogation_Position=695; Antisense; AAGGACACGCTCGACATGGAGGCCA
>probe:Drosophila_2:1632189_at:76:665; Interrogation_Position=722; Antisense; TACAAGGCCTTGTACGAGTCCCAGC
>probe:Drosophila_2:1632189_at:21:625; Interrogation_Position=750; Antisense; TGCCACCCAACCAGAGTACTTATAA
>probe:Drosophila_2:1632189_at:492:489; Interrogation_Position=765; Antisense; GTACTTATAATGCACCGCTGGGAAC
>probe:Drosophila_2:1632189_at:528:253; Interrogation_Position=793; Antisense; CAACTACCTGTTCGAACTGGACAAA
>probe:Drosophila_2:1632189_at:524:105; Interrogation_Position=896; Antisense; AGAAATCCCGTGAAGGTCGCCACTT
>probe:Drosophila_2:1632189_at:546:313; Interrogation_Position=951; Antisense; GCCAGAAGTTCATCACGAGCACGTG

Paste this into a BLAST search page for me
CACTTGTTCGTGCAGTTCATCAATGACGATCGGCTGCTAGCACTGTGATTAATAAAGTTCTTACCTCGGGCAGCAATGTTCCCTACACCAGAGAGACTTTGAGACTTTTGATGCTCTGTGCCAGCGAGGAGCCGCAGAGCAACAACCGTTACAGTCCGCTGGTGGTAGTCTTGCCAAGGACACGCTCGACATGGAGGCCATACAAGGCCTTGTACGAGTCCCAGCTGCCACCCAACCAGAGTACTTATAAGTACTTATAATGCACCGCTGGGAACCAACTACCTGTTCGAACTGGACAAAAGAAATCCCGTGAAGGTCGCCACTTGCCAGAAGTTCATCACGAGCACGTG

Full Affymetrix probeset data:

Annotations for 1632189_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720