FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632190_at:

>probe:Drosophila_2:1632190_at:572:107; Interrogation_Position=109; Antisense; AGCAATGGGTTCTCCGACGACTCCG
>probe:Drosophila_2:1632190_at:350:449; Interrogation_Position=152; Antisense; GATCCTATATTGAACTGGCCAGCGG
>probe:Drosophila_2:1632190_at:208:315; Interrogation_Position=178; Antisense; GCCATGCGTCGCGTGGAGGACATAC
>probe:Drosophila_2:1632190_at:145:29; Interrogation_Position=199; Antisense; ATACGCACCGAGGACTTCATCCAGT
>probe:Drosophila_2:1632190_at:142:577; Interrogation_Position=225; Antisense; GGCGCTGCGCAGTCAACTATTTGAG
>probe:Drosophila_2:1632190_at:145:149; Interrogation_Position=240; Antisense; ACTATTTGAGCTGCGAGAGGCGACA
>probe:Drosophila_2:1632190_at:438:125; Interrogation_Position=356; Antisense; AGCCGGGTCATCCAATGTTTGTTTA
>probe:Drosophila_2:1632190_at:151:503; Interrogation_Position=414; Antisense; GTCGCTGCAGCTGTACGAGCTCAAA
>probe:Drosophila_2:1632190_at:570:151; Interrogation_Position=461; Antisense; ACATATGTTTGTCGCTGGTGCCAAA
>probe:Drosophila_2:1632190_at:615:233; Interrogation_Position=567; Antisense; AATGCCAGTGCCGATGGGTTCTCCG
>probe:Drosophila_2:1632190_at:626:631; Interrogation_Position=588; Antisense; TCCGCCTACCGGAAGCTATGGATTT
>probe:Drosophila_2:1632190_at:438:459; Interrogation_Position=608; Antisense; GATTTCTGCCGTTTAAGCATCCGTA
>probe:Drosophila_2:1632190_at:646:59; Interrogation_Position=637; Antisense; ATGTACGCCCAAATGGCCAGTTTTG
>probe:Drosophila_2:1632190_at:515:91; Interrogation_Position=655; Antisense; AGTTTTGTGGCCGTGTACACCCAGC

Paste this into a BLAST search page for me
AGCAATGGGTTCTCCGACGACTCCGGATCCTATATTGAACTGGCCAGCGGGCCATGCGTCGCGTGGAGGACATACATACGCACCGAGGACTTCATCCAGTGGCGCTGCGCAGTCAACTATTTGAGACTATTTGAGCTGCGAGAGGCGACAAGCCGGGTCATCCAATGTTTGTTTAGTCGCTGCAGCTGTACGAGCTCAAAACATATGTTTGTCGCTGGTGCCAAAAATGCCAGTGCCGATGGGTTCTCCGTCCGCCTACCGGAAGCTATGGATTTGATTTCTGCCGTTTAAGCATCCGTAATGTACGCCCAAATGGCCAGTTTTGAGTTTTGTGGCCGTGTACACCCAGC

Full Affymetrix probeset data:

Annotations for 1632190_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720