FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632192_at:

>probe:Drosophila_2:1632192_at:49:553; Interrogation_Position=252; Antisense; GGAGAATACCGAGCCACTTAGCACC
>probe:Drosophila_2:1632192_at:357:459; Interrogation_Position=313; Antisense; GATTTGGAATTGTCCATCCGCACGC
>probe:Drosophila_2:1632192_at:404:239; Interrogation_Position=342; Antisense; CAATACCTACGGAGCCCCTGAAGAG
>probe:Drosophila_2:1632192_at:326:615; Interrogation_Position=360; Antisense; TGAAGAGCAGGATCCCCTCGTGCCG
>probe:Drosophila_2:1632192_at:624:583; Interrogation_Position=440; Antisense; TGGATGCCGTCGAGGACTTTGCCGC
>probe:Drosophila_2:1632192_at:564:403; Interrogation_Position=454; Antisense; GACTTTGCCGCCGATGTCACTGTTG
>probe:Drosophila_2:1632192_at:242:61; Interrogation_Position=467; Antisense; ATGTCACTGTTGCTGCTGATGGCGA
>probe:Drosophila_2:1632192_at:201:607; Interrogation_Position=483; Antisense; TGATGGCGAGCAGCCTGTTGCTGAT
>probe:Drosophila_2:1632192_at:226:599; Interrogation_Position=567; Antisense; TGTCACCCCGGCTGGAGCCTATGGA
>probe:Drosophila_2:1632192_at:477:261; Interrogation_Position=603; Antisense; CACCTACGGTGTGCCTGAGCTGAGC
>probe:Drosophila_2:1632192_at:310:199; Interrogation_Position=709; Antisense; AACGAGCTCTCTAGTGGTCGCCTGA
>probe:Drosophila_2:1632192_at:528:527; Interrogation_Position=756; Antisense; GGGAACACAGTTTGGTCGCCTCATC
>probe:Drosophila_2:1632192_at:555:133; Interrogation_Position=798; Antisense; ACGCCAGCGCCTGAGGAGCGAACGA
>probe:Drosophila_2:1632192_at:449:551; Interrogation_Position=812; Antisense; GGAGCGAACGACTCAGGCGGATTTA

Paste this into a BLAST search page for me
GGAGAATACCGAGCCACTTAGCACCGATTTGGAATTGTCCATCCGCACGCCAATACCTACGGAGCCCCTGAAGAGTGAAGAGCAGGATCCCCTCGTGCCGTGGATGCCGTCGAGGACTTTGCCGCGACTTTGCCGCCGATGTCACTGTTGATGTCACTGTTGCTGCTGATGGCGATGATGGCGAGCAGCCTGTTGCTGATTGTCACCCCGGCTGGAGCCTATGGACACCTACGGTGTGCCTGAGCTGAGCAACGAGCTCTCTAGTGGTCGCCTGAGGGAACACAGTTTGGTCGCCTCATCACGCCAGCGCCTGAGGAGCGAACGAGGAGCGAACGACTCAGGCGGATTTA

Full Affymetrix probeset data:

Annotations for 1632192_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720