FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632194_at:

>probe:Drosophila_2:1632194_at:57:235; Interrogation_Position=6122; Antisense; AATGCGCGCTGGGAGAACTTAAAAC
>probe:Drosophila_2:1632194_at:236:181; Interrogation_Position=6142; Antisense; AAAACCACAACTAAGCGAACTCTGC
>probe:Drosophila_2:1632194_at:223:111; Interrogation_Position=6201; Antisense; AGCACCGCCTGTGCCAGAGTGAAAT
>probe:Drosophila_2:1632194_at:373:85; Interrogation_Position=6218; Antisense; AGTGAAATCTCGCAGAGCCTCAGCT
>probe:Drosophila_2:1632194_at:383:103; Interrogation_Position=6231; Antisense; AGAGCCTCAGCTGCTTGGTGCACGG
>probe:Drosophila_2:1632194_at:536:509; Interrogation_Position=6248; Antisense; GTGCACGGCATGTGCATTGTCTGTC
>probe:Drosophila_2:1632194_at:332:3; Interrogation_Position=6263; Antisense; ATTGTCTGTCCCGAGATGGAGTCTT
>probe:Drosophila_2:1632194_at:319:99; Interrogation_Position=6276; Antisense; AGATGGAGTCTTCCACGGTGCTTAA
>probe:Drosophila_2:1632194_at:401:301; Interrogation_Position=6288; Antisense; CCACGGTGCTTAAGGTGGCCCTGGA
>probe:Drosophila_2:1632194_at:709:93; Interrogation_Position=6333; Antisense; AGTTCGCCTCAAAGGAGCTGCGCAT
>probe:Drosophila_2:1632194_at:386:333; Interrogation_Position=6361; Antisense; GCTGGAGGAGCTACTAGACAAAATC
>probe:Drosophila_2:1632194_at:271:177; Interrogation_Position=6388; Antisense; AAACGAGCCACCATTTAGCGAGCGG
>probe:Drosophila_2:1632194_at:694:567; Interrogation_Position=6411; Antisense; GGCAGCAACCCACCATGATGGAGAT
>probe:Drosophila_2:1632194_at:523:345; Interrogation_Position=6552; Antisense; GCATAGGTTTGAGTACGGCATCATT

Paste this into a BLAST search page for me
AATGCGCGCTGGGAGAACTTAAAACAAAACCACAACTAAGCGAACTCTGCAGCACCGCCTGTGCCAGAGTGAAATAGTGAAATCTCGCAGAGCCTCAGCTAGAGCCTCAGCTGCTTGGTGCACGGGTGCACGGCATGTGCATTGTCTGTCATTGTCTGTCCCGAGATGGAGTCTTAGATGGAGTCTTCCACGGTGCTTAACCACGGTGCTTAAGGTGGCCCTGGAAGTTCGCCTCAAAGGAGCTGCGCATGCTGGAGGAGCTACTAGACAAAATCAAACGAGCCACCATTTAGCGAGCGGGGCAGCAACCCACCATGATGGAGATGCATAGGTTTGAGTACGGCATCATT

Full Affymetrix probeset data:

Annotations for 1632194_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720