Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632195_at:

>probe:Drosophila_2:1632195_at:223:579; Interrogation_Position=1009; Antisense; GGCCATTTATATACCAGTCTCCATT
>probe:Drosophila_2:1632195_at:466:499; Interrogation_Position=1025; Antisense; GTCTCCATTCTCTGGGTGATCAATA
>probe:Drosophila_2:1632195_at:583:605; Interrogation_Position=1041; Antisense; TGATCAATATCTCTCTGCTGCAGTG
>probe:Drosophila_2:1632195_at:243:699; Interrogation_Position=1104; Antisense; TTTTGATTGCGGTGCTAACGCCAGC
>probe:Drosophila_2:1632195_at:27:471; Interrogation_Position=1153; Antisense; GTTCCTCATCGTTGGAATCCTGAGT
>probe:Drosophila_2:1632195_at:548:543; Interrogation_Position=1199; Antisense; GGATTTCTGCTCTATTTCTTTCACA
>probe:Drosophila_2:1632195_at:200:611; Interrogation_Position=1299; Antisense; TGACGCAGGCGGTTGTCAACGCAGT
>probe:Drosophila_2:1632195_at:610:563; Interrogation_Position=1328; Antisense; GGCAATCAGACCCACTAGGATGCAT
>probe:Drosophila_2:1632195_at:313:173; Interrogation_Position=1361; Antisense; AAACCAGTTCGTCAACGTCGCTGAA
>probe:Drosophila_2:1632195_at:14:461; Interrogation_Position=1402; Antisense; GTTGTCCCTATTTTTATATTCGCTA
>probe:Drosophila_2:1632195_at:568:677; Interrogation_Position=1425; Antisense; TAGAGAGCTGATCACGTTGGTTCCA
>probe:Drosophila_2:1632195_at:342:469; Interrogation_Position=1444; Antisense; GTTCCAGCTTCGTGGTTTGTATTCA
>probe:Drosophila_2:1632195_at:534:191; Interrogation_Position=1477; Antisense; AACTTTTTCGCGACTGTATATTCAT
>probe:Drosophila_2:1632195_at:207:317; Interrogation_Position=972; Antisense; GCCTCTTGTCGCTGATGTGCATCTA

Paste this into a BLAST search page for me
GGCCATTTATATACCAGTCTCCATTGTCTCCATTCTCTGGGTGATCAATATGATCAATATCTCTCTGCTGCAGTGTTTTGATTGCGGTGCTAACGCCAGCGTTCCTCATCGTTGGAATCCTGAGTGGATTTCTGCTCTATTTCTTTCACATGACGCAGGCGGTTGTCAACGCAGTGGCAATCAGACCCACTAGGATGCATAAACCAGTTCGTCAACGTCGCTGAAGTTGTCCCTATTTTTATATTCGCTATAGAGAGCTGATCACGTTGGTTCCAGTTCCAGCTTCGTGGTTTGTATTCAAACTTTTTCGCGACTGTATATTCATGCCTCTTGTCGCTGATGTGCATCTA

Full Affymetrix probeset data:

Annotations for 1632195_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime