FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632196_at:

>probe:Drosophila_2:1632196_at:462:363; Interrogation_Position=1821; Antisense; GAATTCCATTAGCATCAGCCAACCG
>probe:Drosophila_2:1632196_at:344:641; Interrogation_Position=1835; Antisense; TCAGCCAACCGCATTTAGTCTAATA
>probe:Drosophila_2:1632196_at:652:179; Interrogation_Position=1873; Antisense; AAACACACAGAATCCACGGGCTAGG
>probe:Drosophila_2:1632196_at:171:139; Interrogation_Position=1888; Antisense; ACGGGCTAGGGATACCGCTTGCTGC
>probe:Drosophila_2:1632196_at:30:299; Interrogation_Position=1903; Antisense; CGCTTGCTGCCCAACTAAAACTATT
>probe:Drosophila_2:1632196_at:576:543; Interrogation_Position=1974; Antisense; GGATACCCGTGAATAACTTATGCGA
>probe:Drosophila_2:1632196_at:350:195; Interrogation_Position=2007; Antisense; AACTGTTCCACAACCGTAGACGAAT
>probe:Drosophila_2:1632196_at:28:485; Interrogation_Position=2022; Antisense; GTAGACGAATTCTGTCCTGCTCCTG
>probe:Drosophila_2:1632196_at:280:33; Interrogation_Position=2086; Antisense; ATCAAGCGATTTCTGTTTGCCTTGC
>probe:Drosophila_2:1632196_at:371:695; Interrogation_Position=2101; Antisense; TTTGCCTTGCGCTTTGATATGCCCG
>probe:Drosophila_2:1632196_at:5:459; Interrogation_Position=2116; Antisense; GATATGCCCGGCTATTATACACCAA
>probe:Drosophila_2:1632196_at:387:683; Interrogation_Position=2131; Antisense; TATACACCAATACTACCCGAACCTA
>probe:Drosophila_2:1632196_at:299:705; Interrogation_Position=2242; Antisense; TTACGAACCGCAACGATGTCTTTTT
>probe:Drosophila_2:1632196_at:545:709; Interrogation_Position=2375; Antisense; TTCAATTACTAAACCGCAAGCCCTT

Paste this into a BLAST search page for me
GAATTCCATTAGCATCAGCCAACCGTCAGCCAACCGCATTTAGTCTAATAAAACACACAGAATCCACGGGCTAGGACGGGCTAGGGATACCGCTTGCTGCCGCTTGCTGCCCAACTAAAACTATTGGATACCCGTGAATAACTTATGCGAAACTGTTCCACAACCGTAGACGAATGTAGACGAATTCTGTCCTGCTCCTGATCAAGCGATTTCTGTTTGCCTTGCTTTGCCTTGCGCTTTGATATGCCCGGATATGCCCGGCTATTATACACCAATATACACCAATACTACCCGAACCTATTACGAACCGCAACGATGTCTTTTTTTCAATTACTAAACCGCAAGCCCTT

Full Affymetrix probeset data:

Annotations for 1632196_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720