FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632197_at:

>probe:Drosophila_2:1632197_at:494:433; Interrogation_Position=1038; Antisense; GAGGGCATGCAGTTCGATCCAGAGA
>probe:Drosophila_2:1632197_at:549:435; Interrogation_Position=1125; Antisense; GAGGATTAGCGTAGCCACAGCATCA
>probe:Drosophila_2:1632197_at:128:251; Interrogation_Position=617; Antisense; CAAGGAGGTCCTGTTGAGCAACATC
>probe:Drosophila_2:1632197_at:730:151; Interrogation_Position=637; Antisense; ACATCAAGCGGAAGCTGGTCTCGCC
>probe:Drosophila_2:1632197_at:264:97; Interrogation_Position=670; Antisense; AGATCCGTGCGGACATCGAGTGCTC
>probe:Drosophila_2:1632197_at:293:431; Interrogation_Position=687; Antisense; GAGTGCTCCTGCTACGGTTACGAGG
>probe:Drosophila_2:1632197_at:460:475; Interrogation_Position=703; Antisense; GTTACGAGGGCATCGACGCTGTCAA
>probe:Drosophila_2:1632197_at:320:283; Interrogation_Position=721; Antisense; CTGTCAAGGCATCGCTCACCAAGGG
>probe:Drosophila_2:1632197_at:372:309; Interrogation_Position=739; Antisense; CCAAGGGCCTGGAGCTGAGCACCGA
>probe:Drosophila_2:1632197_at:335:11; Interrogation_Position=774; Antisense; ATTCGCATCAACCTGATAGCACCGC
>probe:Drosophila_2:1632197_at:373:131; Interrogation_Position=794; Antisense; ACCGCCACTCTATGTAATGACCACA
>probe:Drosophila_2:1632197_at:194:57; Interrogation_Position=810; Antisense; ATGACCACATCCACTACCAAGAAGA
>probe:Drosophila_2:1632197_at:506:81; Interrogation_Position=856; Antisense; AGGTGGCCATTGAGCACATTCGCGC
>probe:Drosophila_2:1632197_at:43:513; Interrogation_Position=912; Antisense; GTGATCATGGCACCCAAACTGGTTA

Paste this into a BLAST search page for me
GAGGGCATGCAGTTCGATCCAGAGAGAGGATTAGCGTAGCCACAGCATCACAAGGAGGTCCTGTTGAGCAACATCACATCAAGCGGAAGCTGGTCTCGCCAGATCCGTGCGGACATCGAGTGCTCGAGTGCTCCTGCTACGGTTACGAGGGTTACGAGGGCATCGACGCTGTCAACTGTCAAGGCATCGCTCACCAAGGGCCAAGGGCCTGGAGCTGAGCACCGAATTCGCATCAACCTGATAGCACCGCACCGCCACTCTATGTAATGACCACAATGACCACATCCACTACCAAGAAGAAGGTGGCCATTGAGCACATTCGCGCGTGATCATGGCACCCAAACTGGTTA

Full Affymetrix probeset data:

Annotations for 1632197_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720