FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632203_at:

>probe:Drosophila_2:1632203_at:219:57; Interrogation_Position=1032; Antisense; ATGAGGTCAGCCATGCAGGTACTCC
>probe:Drosophila_2:1632203_at:225:265; Interrogation_Position=1047; Antisense; CAGGTACTCCCGTGGATGTGGCCAA
>probe:Drosophila_2:1632203_at:105:443; Interrogation_Position=1061; Antisense; GATGTGGCCAACTTTGTAGCTGCAA
>probe:Drosophila_2:1632203_at:382:131; Interrogation_Position=552; Antisense; ACCGACACCATACGTACCATAGAAA
>probe:Drosophila_2:1632203_at:349:1; Interrogation_Position=591; Antisense; AGTCGTCGCCCCAGGGAAATGGTCG
>probe:Drosophila_2:1632203_at:87:169; Interrogation_Position=607; Antisense; AAATGGTCGACAGATCATCATCGTC
>probe:Drosophila_2:1632203_at:680:35; Interrogation_Position=623; Antisense; ATCATCGTCAACAATGGTCAGCAGG
>probe:Drosophila_2:1632203_at:77:477; Interrogation_Position=653; Antisense; GTTTTGCACAATGAGACCACTATTT
>probe:Drosophila_2:1632203_at:576:709; Interrogation_Position=676; Antisense; TTCAGGAGAATCCTCCGCAGTGGTC
>probe:Drosophila_2:1632203_at:587:563; Interrogation_Position=784; Antisense; GGAATCCACGGAATCGGAGGCAACT
>probe:Drosophila_2:1632203_at:395:441; Interrogation_Position=824; Antisense; GATGGTGGCATCATTTGCTTTCCCA
>probe:Drosophila_2:1632203_at:528:19; Interrogation_Position=836; Antisense; ATTTGCTTTCCCATCATGCTAAACG
>probe:Drosophila_2:1632203_at:151:383; Interrogation_Position=899; Antisense; GAACGGGTCGTTTGCTTTCCAGCTC
>probe:Drosophila_2:1632203_at:385:291; Interrogation_Position=976; Antisense; CGTTGCCGGCGATATTGTTGGTCGT

Paste this into a BLAST search page for me
ATGAGGTCAGCCATGCAGGTACTCCCAGGTACTCCCGTGGATGTGGCCAAGATGTGGCCAACTTTGTAGCTGCAAACCGACACCATACGTACCATAGAAAAGTCGTCGCCCCAGGGAAATGGTCGAAATGGTCGACAGATCATCATCGTCATCATCGTCAACAATGGTCAGCAGGGTTTTGCACAATGAGACCACTATTTTTCAGGAGAATCCTCCGCAGTGGTCGGAATCCACGGAATCGGAGGCAACTGATGGTGGCATCATTTGCTTTCCCAATTTGCTTTCCCATCATGCTAAACGGAACGGGTCGTTTGCTTTCCAGCTCCGTTGCCGGCGATATTGTTGGTCGT

Full Affymetrix probeset data:

Annotations for 1632203_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720