FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632204_at:

>probe:Drosophila_2:1632204_at:591:81; Interrogation_Position=2105; Antisense; AGTGGGACCGACTCAGCGGTAGTTT
>probe:Drosophila_2:1632204_at:64:331; Interrogation_Position=2120; Antisense; GCGGTAGTTTTGTTTGAGCTCGAAT
>probe:Drosophila_2:1632204_at:353:477; Interrogation_Position=2126; Antisense; GTTTTGTTTGAGCTCGAATCGATCT
>probe:Drosophila_2:1632204_at:477:367; Interrogation_Position=2141; Antisense; GAATCGATCTACTGGATCCACGAAT
>probe:Drosophila_2:1632204_at:105:545; Interrogation_Position=2154; Antisense; GGATCCACGAATATCGAATCCCGAA
>probe:Drosophila_2:1632204_at:397:365; Interrogation_Position=2169; Antisense; GAATCCCGAACTCTGAAAGTCAAAA
>probe:Drosophila_2:1632204_at:12:97; Interrogation_Position=2194; Antisense; AGATCTCATAGAAAGAAGTCTTGTA
>probe:Drosophila_2:1632204_at:520:87; Interrogation_Position=2210; Antisense; AGTCTTGTATGAGTTGTTACTTAGC
>probe:Drosophila_2:1632204_at:298:475; Interrogation_Position=2225; Antisense; GTTACTTAGCGAGAAGCAGTTACAA
>probe:Drosophila_2:1632204_at:306:165; Interrogation_Position=2272; Antisense; AAATCCTATCTTTATGGTATGTTTA
>probe:Drosophila_2:1632204_at:139:511; Interrogation_Position=2317; Antisense; GTGAAATTCTAGTACTCAAGTCGAA
>probe:Drosophila_2:1632204_at:365:489; Interrogation_Position=2328; Antisense; GTACTCAAGTCGAATGTGTTTGTCT
>probe:Drosophila_2:1632204_at:589:293; Interrogation_Position=2338; Antisense; CGAATGTGTTTGTCTTTGTTGCCTA
>probe:Drosophila_2:1632204_at:83:481; Interrogation_Position=2345; Antisense; GTTTGTCTTTGTTGCCTATGGAAGA

Paste this into a BLAST search page for me
AGTGGGACCGACTCAGCGGTAGTTTGCGGTAGTTTTGTTTGAGCTCGAATGTTTTGTTTGAGCTCGAATCGATCTGAATCGATCTACTGGATCCACGAATGGATCCACGAATATCGAATCCCGAAGAATCCCGAACTCTGAAAGTCAAAAAGATCTCATAGAAAGAAGTCTTGTAAGTCTTGTATGAGTTGTTACTTAGCGTTACTTAGCGAGAAGCAGTTACAAAAATCCTATCTTTATGGTATGTTTAGTGAAATTCTAGTACTCAAGTCGAAGTACTCAAGTCGAATGTGTTTGTCTCGAATGTGTTTGTCTTTGTTGCCTAGTTTGTCTTTGTTGCCTATGGAAGA

Full Affymetrix probeset data:

Annotations for 1632204_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720