FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632205_at:

>probe:Drosophila_2:1632205_at:366:179; Interrogation_Position=106; Antisense; AAACATTTGTTTGTGTCCTTCCTCA
>probe:Drosophila_2:1632205_at:571:515; Interrogation_Position=118; Antisense; GTGTCCTTCCTCAAGCCGAATGTCA
>probe:Drosophila_2:1632205_at:492:347; Interrogation_Position=156; Antisense; GCATGGCCGGGCACTTAATCAAATG
>probe:Drosophila_2:1632205_at:546:355; Interrogation_Position=166; Antisense; GCACTTAATCAAATGGCCGCCATCA
>probe:Drosophila_2:1632205_at:283:373; Interrogation_Position=228; Antisense; GAAGGGCTCCATACCAAACATCAAT
>probe:Drosophila_2:1632205_at:271:27; Interrogation_Position=251; Antisense; ATAGCATTGCCGAGCTGATGCCGCA
>probe:Drosophila_2:1632205_at:517:159; Interrogation_Position=339; Antisense; ACAAGCCCGCAGCAGCTTTGTGGAC
>probe:Drosophila_2:1632205_at:268:545; Interrogation_Position=381; Antisense; GGATAAATTACACCACTCGCTGGGC
>probe:Drosophila_2:1632205_at:726:329; Interrogation_Position=399; Antisense; GCTGGGCGGACATCTATCCCACGAT
>probe:Drosophila_2:1632205_at:681:137; Interrogation_Position=419; Antisense; ACGATCCTAGCAAGACCGGCAGTGT
>probe:Drosophila_2:1632205_at:168:85; Interrogation_Position=439; Antisense; AGTGTCCATCCGATGCTCACGGTGA
>probe:Drosophila_2:1632205_at:247:411; Interrogation_Position=485; Antisense; GACCCAGCATGTTCCAGGCGAGCAA
>probe:Drosophila_2:1632205_at:618:99; Interrogation_Position=566; Antisense; AGATGTCTCGCAACTCCTCGAAGAA
>probe:Drosophila_2:1632205_at:604:317; Interrogation_Position=90; Antisense; GCCGTTGGACCTGGCCAAACATTTG

Paste this into a BLAST search page for me
AAACATTTGTTTGTGTCCTTCCTCAGTGTCCTTCCTCAAGCCGAATGTCAGCATGGCCGGGCACTTAATCAAATGGCACTTAATCAAATGGCCGCCATCAGAAGGGCTCCATACCAAACATCAATATAGCATTGCCGAGCTGATGCCGCAACAAGCCCGCAGCAGCTTTGTGGACGGATAAATTACACCACTCGCTGGGCGCTGGGCGGACATCTATCCCACGATACGATCCTAGCAAGACCGGCAGTGTAGTGTCCATCCGATGCTCACGGTGAGACCCAGCATGTTCCAGGCGAGCAAAGATGTCTCGCAACTCCTCGAAGAAGCCGTTGGACCTGGCCAAACATTTG

Full Affymetrix probeset data:

Annotations for 1632205_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720