FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632206_at:

>probe:Drosophila_2:1632206_at:593:93; Interrogation_Position=1015; Antisense; AGTTCCTCCAAGCATCACGAAAGCG
>probe:Drosophila_2:1632206_at:418:359; Interrogation_Position=1049; Antisense; GCAAGCGCAGATCCAAGCAGTAATT
>probe:Drosophila_2:1632206_at:617:107; Interrogation_Position=608; Antisense; AGAACTGGCAGTGCGACACGTGCTG
>probe:Drosophila_2:1632206_at:478:399; Interrogation_Position=622; Antisense; GACACGTGCTGCAACAAGCCAACGA
>probe:Drosophila_2:1632206_at:402:203; Interrogation_Position=637; Antisense; AAGCCAACGAGCAGCGGGAGGACAA
>probe:Drosophila_2:1632206_at:484:525; Interrogation_Position=652; Antisense; GGGAGGACAACATCCTCTGCAGCGG
>probe:Drosophila_2:1632206_at:668:657; Interrogation_Position=680; Antisense; TAACGCCAACTGTCTTCATAGCCGA
>probe:Drosophila_2:1632206_at:326:25; Interrogation_Position=697; Antisense; ATAGCCGACGAACCCATGCCGTTGA
>probe:Drosophila_2:1632206_at:138:49; Interrogation_Position=712; Antisense; ATGCCGTTGACCAGCAAAGCCAAAT
>probe:Drosophila_2:1632206_at:198:175; Interrogation_Position=727; Antisense; AAAGCCAAATCGTCGGTCGCGTCGT
>probe:Drosophila_2:1632206_at:326:115; Interrogation_Position=805; Antisense; AGCAGTTCCACGAATGCCAGCAGCA
>probe:Drosophila_2:1632206_at:476:501; Interrogation_Position=867; Antisense; GTCGTCGTCCAAATCGCACAAGGAA
>probe:Drosophila_2:1632206_at:467:371; Interrogation_Position=889; Antisense; GAAGAACGATCCTCTAAGTCCACGG
>probe:Drosophila_2:1632206_at:597:113; Interrogation_Position=991; Antisense; AGCACCAAATCCAGCTCCAAGAGCA

Paste this into a BLAST search page for me
AGTTCCTCCAAGCATCACGAAAGCGGCAAGCGCAGATCCAAGCAGTAATTAGAACTGGCAGTGCGACACGTGCTGGACACGTGCTGCAACAAGCCAACGAAAGCCAACGAGCAGCGGGAGGACAAGGGAGGACAACATCCTCTGCAGCGGTAACGCCAACTGTCTTCATAGCCGAATAGCCGACGAACCCATGCCGTTGAATGCCGTTGACCAGCAAAGCCAAATAAAGCCAAATCGTCGGTCGCGTCGTAGCAGTTCCACGAATGCCAGCAGCAGTCGTCGTCCAAATCGCACAAGGAAGAAGAACGATCCTCTAAGTCCACGGAGCACCAAATCCAGCTCCAAGAGCA

Full Affymetrix probeset data:

Annotations for 1632206_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720