FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632210_at:

>probe:Drosophila_2:1632210_at:572:157; Interrogation_Position=1022; Antisense; AAACTTTCGTGGTGACAACGGCGCA
>probe:Drosophila_2:1632210_at:40:159; Interrogation_Position=1036; Antisense; ACAACGGCGCAGTTGATTTCCGAAA
>probe:Drosophila_2:1632210_at:619:225; Interrogation_Position=1088; Antisense; AAGGCGATGTGCATACCTACGCTGT
>probe:Drosophila_2:1632210_at:221:473; Interrogation_Position=1120; Antisense; GTTCACAAGCATCCCAAATTCGTTA
>probe:Drosophila_2:1632210_at:246:581; Interrogation_Position=1148; Antisense; TGGCCCAAAACGACATAGCTCTGCT
>probe:Drosophila_2:1632210_at:177:565; Interrogation_Position=1200; Antisense; GGAATCGATTCGACCGATCTGCCTG
>probe:Drosophila_2:1632210_at:30:95; Interrogation_Position=1256; Antisense; AGTTCCAAAGGCGTGCTGCTGATCC
>probe:Drosophila_2:1632210_at:208:143; Interrogation_Position=1318; Antisense; ACTAACGTGGTGGTGCGGCGAACAA
>probe:Drosophila_2:1632210_at:373:337; Interrogation_Position=1355; Antisense; GCTACCGGGAGGATCACCAAGACAT
>probe:Drosophila_2:1632210_at:94:267; Interrogation_Position=1390; Antisense; CAGTTGTGCATGGAAAGCCCTTCTC
>probe:Drosophila_2:1632210_at:3:595; Interrogation_Position=1430; Antisense; TGGGCATTGGCAGTCCCTTGGTAAA
>probe:Drosophila_2:1632210_at:655:415; Interrogation_Position=1519; Antisense; GAGCCTTTCGCTTCAAATGTCTACA
>probe:Drosophila_2:1632210_at:480:231; Interrogation_Position=1546; Antisense; AATGTTCTCGAATACTTGGACTGGA
>probe:Drosophila_2:1632210_at:166:639; Interrogation_Position=998; Antisense; TCTCAAACGGCGCACTTATTTCGAA

Paste this into a BLAST search page for me
AAACTTTCGTGGTGACAACGGCGCAACAACGGCGCAGTTGATTTCCGAAAAAGGCGATGTGCATACCTACGCTGTGTTCACAAGCATCCCAAATTCGTTATGGCCCAAAACGACATAGCTCTGCTGGAATCGATTCGACCGATCTGCCTGAGTTCCAAAGGCGTGCTGCTGATCCACTAACGTGGTGGTGCGGCGAACAAGCTACCGGGAGGATCACCAAGACATCAGTTGTGCATGGAAAGCCCTTCTCTGGGCATTGGCAGTCCCTTGGTAAAGAGCCTTTCGCTTCAAATGTCTACAAATGTTCTCGAATACTTGGACTGGATCTCAAACGGCGCACTTATTTCGAA

Full Affymetrix probeset data:

Annotations for 1632210_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720