FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632211_at:

>probe:Drosophila_2:1632211_at:630:591; Interrogation_Position=411; Antisense; TGGTGGCCGGCTCCAACAACTTCAA
>probe:Drosophila_2:1632211_at:441:149; Interrogation_Position=429; Antisense; ACTTCAATGGCGCAACTGTCGGTAA
>probe:Drosophila_2:1632211_at:102:539; Interrogation_Position=449; Antisense; GGTAATGTGGACTCTGCCGTGCCTT
>probe:Drosophila_2:1632211_at:328:177; Interrogation_Position=490; Antisense; AAACGTTCTTGGACAGCAGGCGCGA
>probe:Drosophila_2:1632211_at:528:55; Interrogation_Position=518; Antisense; ATGAACATCAATGTGCCCAACGCCT
>probe:Drosophila_2:1632211_at:572:349; Interrogation_Position=562; Antisense; GCAGTCCCAAAATCGATTGTCCGCT
>probe:Drosophila_2:1632211_at:242:465; Interrogation_Position=576; Antisense; GATTGTCCGCTCAGGGATTAGCTTC
>probe:Drosophila_2:1632211_at:520:107; Interrogation_Position=659; Antisense; AGAATTAATACTAACCACCCGCTCA
>probe:Drosophila_2:1632211_at:398:619; Interrogation_Position=718; Antisense; TGCTGCTCCAGCTGTCGTTAAAACT
>probe:Drosophila_2:1632211_at:664:611; Interrogation_Position=742; Antisense; TGAAACTAGTGCAACCACCTCTGGG
>probe:Drosophila_2:1632211_at:328:203; Interrogation_Position=772; Antisense; AACCTCAGCTTCAGCGAGCGCAGAA
>probe:Drosophila_2:1632211_at:417:241; Interrogation_Position=820; Antisense; AATAGCACGGAAGTACCCACTCTGG
>probe:Drosophila_2:1632211_at:329:281; Interrogation_Position=839; Antisense; CTCTGGCTACCGGAGTACAAGCGAA
>probe:Drosophila_2:1632211_at:345:345; Interrogation_Position=866; Antisense; GCATTCAATGTTAGCCTACCATCTG

Paste this into a BLAST search page for me
TGGTGGCCGGCTCCAACAACTTCAAACTTCAATGGCGCAACTGTCGGTAAGGTAATGTGGACTCTGCCGTGCCTTAAACGTTCTTGGACAGCAGGCGCGAATGAACATCAATGTGCCCAACGCCTGCAGTCCCAAAATCGATTGTCCGCTGATTGTCCGCTCAGGGATTAGCTTCAGAATTAATACTAACCACCCGCTCATGCTGCTCCAGCTGTCGTTAAAACTTGAAACTAGTGCAACCACCTCTGGGAACCTCAGCTTCAGCGAGCGCAGAAAATAGCACGGAAGTACCCACTCTGGCTCTGGCTACCGGAGTACAAGCGAAGCATTCAATGTTAGCCTACCATCTG

Full Affymetrix probeset data:

Annotations for 1632211_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720