FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632212_at:

>probe:Drosophila_2:1632212_at:729:159; Interrogation_Position=188; Antisense; ACAACATCTGTATTCGCGCACGTAT
>probe:Drosophila_2:1632212_at:597:41; Interrogation_Position=211; Antisense; ATCGGCATCGCCAAGCTATAGCTAT
>probe:Drosophila_2:1632212_at:660:25; Interrogation_Position=228; Antisense; ATAGCTATAGCCATACTGACTCACC
>probe:Drosophila_2:1632212_at:127:413; Interrogation_Position=255; Antisense; GACCGCCGGACGACAGTGGAATCAA
>probe:Drosophila_2:1632212_at:125:507; Interrogation_Position=361; Antisense; GTGCCATTACCTGCTACGAATGTGA
>probe:Drosophila_2:1632212_at:7:11; Interrogation_Position=385; Antisense; ATTCCGTCAATAATCCAGGGTGTGG
>probe:Drosophila_2:1632212_at:512:523; Interrogation_Position=422; Antisense; GGGCGATGACATATCCACGACGGAT
>probe:Drosophila_2:1632212_at:235:583; Interrogation_Position=457; Antisense; TGGCGAACATGCGATCCCTGGGAGC
>probe:Drosophila_2:1632212_at:289:369; Interrogation_Position=514; Antisense; GAATGCCAGGAGACACGCGCTTCGT
>probe:Drosophila_2:1632212_at:456:439; Interrogation_Position=539; Antisense; GAGGCGCTCCTGTTACTTTGGCGAT
>probe:Drosophila_2:1632212_at:160:95; Interrogation_Position=599; Antisense; AGATCCTGTGGTGCCCTTTATGAAC
>probe:Drosophila_2:1632212_at:107:617; Interrogation_Position=633; Antisense; TGCACACTGTGCGATACGGATTTGT
>probe:Drosophila_2:1632212_at:346:19; Interrogation_Position=652; Antisense; ATTTGTGCAACGCAGCCGCTGGATT
>probe:Drosophila_2:1632212_at:562:537; Interrogation_Position=692; Antisense; GGTCATTGCCCTTTCGATACTCGGA

Paste this into a BLAST search page for me
ACAACATCTGTATTCGCGCACGTATATCGGCATCGCCAAGCTATAGCTATATAGCTATAGCCATACTGACTCACCGACCGCCGGACGACAGTGGAATCAAGTGCCATTACCTGCTACGAATGTGAATTCCGTCAATAATCCAGGGTGTGGGGGCGATGACATATCCACGACGGATTGGCGAACATGCGATCCCTGGGAGCGAATGCCAGGAGACACGCGCTTCGTGAGGCGCTCCTGTTACTTTGGCGATAGATCCTGTGGTGCCCTTTATGAACTGCACACTGTGCGATACGGATTTGTATTTGTGCAACGCAGCCGCTGGATTGGTCATTGCCCTTTCGATACTCGGA

Full Affymetrix probeset data:

Annotations for 1632212_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720