Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632213_s_at:

>probe:Drosophila_2:1632213_s_at:179:23; Interrogation_Position=159; Antisense; ATATCACAATGGACGCAGTGCAGCA
>probe:Drosophila_2:1632213_s_at:426:155; Interrogation_Position=192; Antisense; ACAGCACTAGCAACATCGACAGCGC
>probe:Drosophila_2:1632213_s_at:12:45; Interrogation_Position=206; Antisense; ATCGACAGCGCCAAATGCCAGAAGC
>probe:Drosophila_2:1632213_s_at:432:95; Interrogation_Position=236; Antisense; AGATTTGTGATCGTAGGCTTGCTGA
>probe:Drosophila_2:1632213_s_at:592:71; Interrogation_Position=250; Antisense; AGGCTTGCTGATCACCATTGGCATT
>probe:Drosophila_2:1632213_s_at:709:273; Interrogation_Position=265; Antisense; CATTGGCATTTTGAGCTGGCACTTC
>probe:Drosophila_2:1632213_s_at:629:609; Interrogation_Position=276; Antisense; TGAGCTGGCACTTCTACGAGTACTT
>probe:Drosophila_2:1632213_s_at:668:135; Interrogation_Position=291; Antisense; ACGAGTACTTCCACAGCAAGCCGCT
>probe:Drosophila_2:1632213_s_at:555:253; Interrogation_Position=319; Antisense; CAAAACGCCGGATGACGTCTTGACC
>probe:Drosophila_2:1632213_s_at:221:497; Interrogation_Position=335; Antisense; GTCTTGACCCTCTCGAAGAATCTGT
>probe:Drosophila_2:1632213_s_at:549:79; Interrogation_Position=375; Antisense; AGGTCAGTCCATACCTCTACAAGGT
>probe:Drosophila_2:1632213_s_at:411:149; Interrogation_Position=419; Antisense; ACTTCAGGTGCTCATGACGATCGCG
>probe:Drosophila_2:1632213_s_at:296:455; Interrogation_Position=61; Antisense; GATCAACGCGAGAGTTTTGGCTGAA
>probe:Drosophila_2:1632213_s_at:371:453; Interrogation_Position=86; Antisense; GATAAACGGCGAGCATCGGGAAAGT

Paste this into a BLAST search page for me
ATATCACAATGGACGCAGTGCAGCAACAGCACTAGCAACATCGACAGCGCATCGACAGCGCCAAATGCCAGAAGCAGATTTGTGATCGTAGGCTTGCTGAAGGCTTGCTGATCACCATTGGCATTCATTGGCATTTTGAGCTGGCACTTCTGAGCTGGCACTTCTACGAGTACTTACGAGTACTTCCACAGCAAGCCGCTCAAAACGCCGGATGACGTCTTGACCGTCTTGACCCTCTCGAAGAATCTGTAGGTCAGTCCATACCTCTACAAGGTACTTCAGGTGCTCATGACGATCGCGGATCAACGCGAGAGTTTTGGCTGAAGATAAACGGCGAGCATCGGGAAAGT

Full Affymetrix probeset data:

Annotations for 1632213_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime