Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632215_at:

>probe:Drosophila_2:1632215_at:669:101; Interrogation_Position=1599; Antisense; AGAGACCACTACATCACCCAGTGAT
>probe:Drosophila_2:1632215_at:64:133; Interrogation_Position=1614; Antisense; ACCCAGTGATGCTGATGATTCAACA
>probe:Drosophila_2:1632215_at:44:459; Interrogation_Position=1630; Antisense; GATTCAACAACCGAGGAGCCCGAAG
>probe:Drosophila_2:1632215_at:652:659; Interrogation_Position=1682; Antisense; TAGAACCCTCAACTACAACCGAAGA
>probe:Drosophila_2:1632215_at:428:209; Interrogation_Position=1703; Antisense; AAGAACCTGAGGATTCGACTACTGA
>probe:Drosophila_2:1632215_at:291:637; Interrogation_Position=1717; Antisense; TCGACTACTGAAGTTCCCGAGGAGT
>probe:Drosophila_2:1632215_at:561:475; Interrogation_Position=1795; Antisense; GTAACGACTACCGTTGAACCGGATG
>probe:Drosophila_2:1632215_at:68:611; Interrogation_Position=1845; Antisense; TGACCAATCGACAAGGGAGGACCTC
>probe:Drosophila_2:1632215_at:662:435; Interrogation_Position=1870; Antisense; GAGGATGTATCCACAACCGCTGTGC
>probe:Drosophila_2:1632215_at:643:133; Interrogation_Position=1896; Antisense; CACTAAGCTACCTTCGACAACGGGT
>probe:Drosophila_2:1632215_at:202:397; Interrogation_Position=1911; Antisense; GACAACGGGTGTTCCTCCTGAAGTT
>probe:Drosophila_2:1632215_at:166:615; Interrogation_Position=1929; Antisense; TGAAGTTCCCATTACCACTCTGGCT
>probe:Drosophila_2:1632215_at:366:583; Interrogation_Position=1949; Antisense; TGGCTCCAGAAGTTCCGTCAACATC
>probe:Drosophila_2:1632215_at:230:715; Interrogation_Position=2070; Antisense; TTCTTACATAGTTTCTCGCCCATTT

Paste this into a BLAST search page for me
AGAGACCACTACATCACCCAGTGATACCCAGTGATGCTGATGATTCAACAGATTCAACAACCGAGGAGCCCGAAGTAGAACCCTCAACTACAACCGAAGAAAGAACCTGAGGATTCGACTACTGATCGACTACTGAAGTTCCCGAGGAGTGTAACGACTACCGTTGAACCGGATGTGACCAATCGACAAGGGAGGACCTCGAGGATGTATCCACAACCGCTGTGCCACTAAGCTACCTTCGACAACGGGTGACAACGGGTGTTCCTCCTGAAGTTTGAAGTTCCCATTACCACTCTGGCTTGGCTCCAGAAGTTCCGTCAACATCTTCTTACATAGTTTCTCGCCCATTT

Full Affymetrix probeset data:

Annotations for 1632215_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime