FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632217_at:

>probe:Drosophila_2:1632217_at:150:235; Interrogation_Position=1054; Antisense; AATGCCAGGGTTTCTCCGTTGATGG
>probe:Drosophila_2:1632217_at:351:45; Interrogation_Position=1088; Antisense; ATCCGTTCTTCGACGAACTTCGTCA
>probe:Drosophila_2:1632217_at:656:715; Interrogation_Position=1106; Antisense; TTCGTCAGGATCCACACCAGCAGTT
>probe:Drosophila_2:1632217_at:403:115; Interrogation_Position=1124; Antisense; AGCAGTTGCCCAACGGCAGGAGCTT
>probe:Drosophila_2:1632217_at:450:115; Interrogation_Position=1144; Antisense; AGCTTGCCGCCGCTGTTTAACTTTA
>probe:Drosophila_2:1632217_at:636:421; Interrogation_Position=1177; Antisense; GAGAAAACCATCGAGCCGGATACAA
>probe:Drosophila_2:1632217_at:31:87; Interrogation_Position=1252; Antisense; AGTGCTGCCCACAGGAACCGCAATA
>probe:Drosophila_2:1632217_at:45:551; Interrogation_Position=1351; Antisense; GGACCTTCGGGCAAGGCGCTCGAAT
>probe:Drosophila_2:1632217_at:155:311; Interrogation_Position=1380; Antisense; GCCAGGCTTTTTGCAACACGATTTG
>probe:Drosophila_2:1632217_at:462:157; Interrogation_Position=1395; Antisense; ACACGATTTGGGAAACGGCGACCAT
>probe:Drosophila_2:1632217_at:647:413; Interrogation_Position=1414; Antisense; GACCATGTGGCTGTGGGCACCATGC
>probe:Drosophila_2:1632217_at:520:551; Interrogation_Position=1458; Antisense; GGAGCAGAACCACTTCGCAGCAGAG
>probe:Drosophila_2:1632217_at:118:27; Interrogation_Position=1574; Antisense; ATAGCACCTACATCAGCGACGACAT
>probe:Drosophila_2:1632217_at:510:135; Interrogation_Position=1592; Antisense; ACGACATGGATGAGGCCTCCGAGTC

Paste this into a BLAST search page for me
AATGCCAGGGTTTCTCCGTTGATGGATCCGTTCTTCGACGAACTTCGTCATTCGTCAGGATCCACACCAGCAGTTAGCAGTTGCCCAACGGCAGGAGCTTAGCTTGCCGCCGCTGTTTAACTTTAGAGAAAACCATCGAGCCGGATACAAAGTGCTGCCCACAGGAACCGCAATAGGACCTTCGGGCAAGGCGCTCGAATGCCAGGCTTTTTGCAACACGATTTGACACGATTTGGGAAACGGCGACCATGACCATGTGGCTGTGGGCACCATGCGGAGCAGAACCACTTCGCAGCAGAGATAGCACCTACATCAGCGACGACATACGACATGGATGAGGCCTCCGAGTC

Full Affymetrix probeset data:

Annotations for 1632217_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720