Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632220_s_at:

>probe:Drosophila_2:1632220_s_at:660:121; Interrogation_Position=116; Antisense; AGCGCCGTAACGGAGGACGCAACAA
>probe:Drosophila_2:1632220_s_at:576:471; Interrogation_Position=219; Antisense; GTTCGTCATCCGCAACATCGTGGAG
>probe:Drosophila_2:1632220_s_at:488:325; Interrogation_Position=257; Antisense; GCGACATCACGGAGGCCAGCATCTG
>probe:Drosophila_2:1632220_s_at:605:113; Interrogation_Position=274; Antisense; AGCATCTGGGACTCGTACGTGCTGC
>probe:Drosophila_2:1632220_s_at:97:509; Interrogation_Position=292; Antisense; GTGCTGCCCAAGCTCTATGCGAAGC
>probe:Drosophila_2:1632220_s_at:602:681; Interrogation_Position=307; Antisense; TATGCGAAGCTCCACTACTGCGTGT
>probe:Drosophila_2:1632220_s_at:99:251; Interrogation_Position=338; Antisense; CAATCCACTCCAAGGTGGTGCGCAA
>probe:Drosophila_2:1632220_s_at:473:371; Interrogation_Position=444; Antisense; GAAGTAGAGGTCTCGTCCAGCCGGA
>probe:Drosophila_2:1632220_s_at:662:127; Interrogation_Position=488; Antisense; ACCACCTGACATCTCCATATGGAGT
>probe:Drosophila_2:1632220_s_at:385:65; Interrogation_Position=506; Antisense; ATGGAGTCTACCAATCTAGCCGGAC
>probe:Drosophila_2:1632220_s_at:381:621; Interrogation_Position=542; Antisense; TGCGTTCCGCTCTGGCGTCGAGGAA
>probe:Drosophila_2:1632220_s_at:632:345; Interrogation_Position=594; Antisense; GCATCCAGTTCTTTTTTAATTTCAA
>probe:Drosophila_2:1632220_s_at:475:179; Interrogation_Position=621; Antisense; AAACAGCGTGCTTCATTGGGAAACA
>probe:Drosophila_2:1632220_s_at:519:525; Interrogation_Position=638; Antisense; GGGAAACAGCTACTACCTACAAACA

Paste this into a BLAST search page for me
AGCGCCGTAACGGAGGACGCAACAAGTTCGTCATCCGCAACATCGTGGAGGCGACATCACGGAGGCCAGCATCTGAGCATCTGGGACTCGTACGTGCTGCGTGCTGCCCAAGCTCTATGCGAAGCTATGCGAAGCTCCACTACTGCGTGTCAATCCACTCCAAGGTGGTGCGCAAGAAGTAGAGGTCTCGTCCAGCCGGAACCACCTGACATCTCCATATGGAGTATGGAGTCTACCAATCTAGCCGGACTGCGTTCCGCTCTGGCGTCGAGGAAGCATCCAGTTCTTTTTTAATTTCAAAAACAGCGTGCTTCATTGGGAAACAGGGAAACAGCTACTACCTACAAACA

Full Affymetrix probeset data:

Annotations for 1632220_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime