FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632221_at:

>probe:Drosophila_2:1632221_at:730:607; Interrogation_Position=293; Antisense; TGAGTGGCAAGATCACCGTGCCGAC
>probe:Drosophila_2:1632221_at:46:121; Interrogation_Position=340; Antisense; AGCGGCGTTCCGGAGGAGCACATTC
>probe:Drosophila_2:1632221_at:121:21; Interrogation_Position=386; Antisense; ATATTCCGCCCAAGAACGCAATGCA
>probe:Drosophila_2:1632221_at:682:135; Interrogation_Position=401; Antisense; ACGCAATGCAGAGCGGCACCGATAA
>probe:Drosophila_2:1632221_at:479:139; Interrogation_Position=425; Antisense; ACGTGAACACCTGGCAAATCGAGTT
>probe:Drosophila_2:1632221_at:455:165; Interrogation_Position=440; Antisense; AAATCGAGTTCGACAACCGCGAGCG
>probe:Drosophila_2:1632221_at:207:421; Interrogation_Position=469; Antisense; GAGAATCCGCTCATGGGCTGGGCCT
>probe:Drosophila_2:1632221_at:532:575; Interrogation_Position=499; Antisense; GGCGACCCATTGTCCAACATGAACG
>probe:Drosophila_2:1632221_at:61:93; Interrogation_Position=527; Antisense; AGTTCGGATCCCCAGAGGAGGCCAT
>probe:Drosophila_2:1632221_at:645:99; Interrogation_Position=540; Antisense; AGAGGAGGCCATCACGTTCTGCGAA
>probe:Drosophila_2:1632221_at:332:417; Interrogation_Position=613; Antisense; GAGCGCGTCAAGAACTACGGCATCA
>probe:Drosophila_2:1632221_at:63:193; Interrogation_Position=637; Antisense; AACTTTGCCTGGAACAAGCGCACGC
>probe:Drosophila_2:1632221_at:221:633; Interrogation_Position=683; Antisense; TCCCCGCAGCTAGCCAGGATTATAG
>probe:Drosophila_2:1632221_at:528:341; Interrogation_Position=733; Antisense; GCTTTGTTCATTATCTGAGTACCCA

Paste this into a BLAST search page for me
TGAGTGGCAAGATCACCGTGCCGACAGCGGCGTTCCGGAGGAGCACATTCATATTCCGCCCAAGAACGCAATGCAACGCAATGCAGAGCGGCACCGATAAACGTGAACACCTGGCAAATCGAGTTAAATCGAGTTCGACAACCGCGAGCGGAGAATCCGCTCATGGGCTGGGCCTGGCGACCCATTGTCCAACATGAACGAGTTCGGATCCCCAGAGGAGGCCATAGAGGAGGCCATCACGTTCTGCGAAGAGCGCGTCAAGAACTACGGCATCAAACTTTGCCTGGAACAAGCGCACGCTCCCCGCAGCTAGCCAGGATTATAGGCTTTGTTCATTATCTGAGTACCCA

Full Affymetrix probeset data:

Annotations for 1632221_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720