FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632223_at:

>probe:Drosophila_2:1632223_at:320:409; Interrogation_Position=1033; Antisense; GACGAACGCCGAAACAAGGACTTTG
>probe:Drosophila_2:1632223_at:585:307; Interrogation_Position=1064; Antisense; CCACGGAGGAGTCAGCTGCTTCAAG
>probe:Drosophila_2:1632223_at:169:69; Interrogation_Position=1103; Antisense; ATGGCTCCTCCTCCAGCAAGGTGGA
>probe:Drosophila_2:1632223_at:607:223; Interrogation_Position=650; Antisense; AAGGAAACACAGTCTCCGCCTTGGG
>probe:Drosophila_2:1632223_at:311:709; Interrogation_Position=678; Antisense; TTACAAGGGCCTTCAGCAGGTGCGG
>probe:Drosophila_2:1632223_at:323:623; Interrogation_Position=698; Antisense; TGCGGGATATAGTCCTGGAGACCAT
>probe:Drosophila_2:1632223_at:504:587; Interrogation_Position=713; Antisense; TGGAGACCATGAACAATGTGCACCC
>probe:Drosophila_2:1632223_at:19:511; Interrogation_Position=730; Antisense; GTGCACCCCATATACAACATTAAGG
>probe:Drosophila_2:1632223_at:117:711; Interrogation_Position=749; Antisense; TTAAGGCTCTGATGATCAAGCGGGA
>probe:Drosophila_2:1632223_at:703:119; Interrogation_Position=773; Antisense; AGCTGATGAAGGATCCGCGTCTGGC
>probe:Drosophila_2:1632223_at:169:581; Interrogation_Position=794; Antisense; TGGCCAACGAGGACTGGTCCCGATT
>probe:Drosophila_2:1632223_at:42:359; Interrogation_Position=848; Antisense; GCAAACGCAAGCAGCCGAAGGTCAA
>probe:Drosophila_2:1632223_at:50:357; Interrogation_Position=876; Antisense; GCAAAAGAAGGAGTACACCCCATTC
>probe:Drosophila_2:1632223_at:190:579; Interrogation_Position=938; Antisense; TGGCCAGCGGAGAGTACTTCCTCAA

Paste this into a BLAST search page for me
GACGAACGCCGAAACAAGGACTTTGCCACGGAGGAGTCAGCTGCTTCAAGATGGCTCCTCCTCCAGCAAGGTGGAAAGGAAACACAGTCTCCGCCTTGGGTTACAAGGGCCTTCAGCAGGTGCGGTGCGGGATATAGTCCTGGAGACCATTGGAGACCATGAACAATGTGCACCCGTGCACCCCATATACAACATTAAGGTTAAGGCTCTGATGATCAAGCGGGAAGCTGATGAAGGATCCGCGTCTGGCTGGCCAACGAGGACTGGTCCCGATTGCAAACGCAAGCAGCCGAAGGTCAAGCAAAAGAAGGAGTACACCCCATTCTGGCCAGCGGAGAGTACTTCCTCAA

Full Affymetrix probeset data:

Annotations for 1632223_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720