Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632225_a_at:

>probe:Drosophila_2:1632225_a_at:210:61; Interrogation_Position=100; Antisense; ATGTATGTCATGTTGCGAGCTTTAA
>probe:Drosophila_2:1632225_a_at:371:613; Interrogation_Position=201; Antisense; TGAACGTCTGGCAAAGGGTCCGAAT
>probe:Drosophila_2:1632225_a_at:239:529; Interrogation_Position=216; Antisense; GGGTCCGAATTTCCATGACTTTGTG
>probe:Drosophila_2:1632225_a_at:268:487; Interrogation_Position=276; Antisense; GTACGATGGAAAGCTACGCCGCGAA
>probe:Drosophila_2:1632225_a_at:380:621; Interrogation_Position=320; Antisense; TGCGATTGCCGCCTTGGTTAAAGAC
>probe:Drosophila_2:1632225_a_at:691:723; Interrogation_Position=333; Antisense; TTGGTTAAAGACCACCATTCCCGTG
>probe:Drosophila_2:1632225_a_at:214:165; Interrogation_Position=374; Antisense; AAATCAAGGCCCAGATGCGCGAGCT
>probe:Drosophila_2:1632225_a_at:381:207; Interrogation_Position=400; Antisense; AAGCTGTCCACCGTCTGCGAGGAGG
>probe:Drosophila_2:1632225_a_at:237:533; Interrogation_Position=428; Antisense; GGTGTCCCAACATCGGCGAGTGCTG
>probe:Drosophila_2:1632225_a_at:3:135; Interrogation_Position=472; Antisense; ACCCAGACAGCCACGATTATGCTTA
>probe:Drosophila_2:1632225_a_at:460:461; Interrogation_Position=486; Antisense; GATTATGCTTATGGGCGACACTTGC
>probe:Drosophila_2:1632225_a_at:441:325; Interrogation_Position=500; Antisense; GCGACACTTGCACCAGAGGCTGTAG
>probe:Drosophila_2:1632225_a_at:518:175; Interrogation_Position=550; Antisense; AAACCACCACCGCTGGATGTAAACG
>probe:Drosophila_2:1632225_a_at:483:543; Interrogation_Position=615; Antisense; GGATTACATTGTTCTGACCTCAGTT

Paste this into a BLAST search page for me
ATGTATGTCATGTTGCGAGCTTTAATGAACGTCTGGCAAAGGGTCCGAATGGGTCCGAATTTCCATGACTTTGTGGTACGATGGAAAGCTACGCCGCGAATGCGATTGCCGCCTTGGTTAAAGACTTGGTTAAAGACCACCATTCCCGTGAAATCAAGGCCCAGATGCGCGAGCTAAGCTGTCCACCGTCTGCGAGGAGGGGTGTCCCAACATCGGCGAGTGCTGACCCAGACAGCCACGATTATGCTTAGATTATGCTTATGGGCGACACTTGCGCGACACTTGCACCAGAGGCTGTAGAAACCACCACCGCTGGATGTAAACGGGATTACATTGTTCTGACCTCAGTT

Full Affymetrix probeset data:

Annotations for 1632225_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime