FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632226_at:

>probe:Drosophila_2:1632226_at:646:431; Interrogation_Position=1014; Antisense; GAGTCTCCCGATGGACAGTGTTAAA
>probe:Drosophila_2:1632226_at:566:585; Interrogation_Position=1064; Antisense; TGGAACTTCCCATCAGGTGTCTTGA
>probe:Drosophila_2:1632226_at:493:533; Interrogation_Position=1079; Antisense; GGTGTCTTGATTGCAATTGCACTGC
>probe:Drosophila_2:1632226_at:295:311; Interrogation_Position=1164; Antisense; CCAACGGACATGGAGCGGCTTATTA
>probe:Drosophila_2:1632226_at:374:367; Interrogation_Position=1197; Antisense; GAATCGGTTCAAAGCGTTCGGCGAT
>probe:Drosophila_2:1632226_at:515:485; Interrogation_Position=1243; Antisense; GTAGAAATAGCTCCCAAAGCACCTT
>probe:Drosophila_2:1632226_at:90:21; Interrogation_Position=1291; Antisense; ATATTTGGTCACTAACGCGACTCGA
>probe:Drosophila_2:1632226_at:672:659; Interrogation_Position=1303; Antisense; TAACGCGACTCGAACTCGGAACTTC
>probe:Drosophila_2:1632226_at:659:635; Interrogation_Position=1326; Antisense; TCGAAGCGAAGGTCGCACTCTCTAA
>probe:Drosophila_2:1632226_at:35:659; Interrogation_Position=1348; Antisense; TAACCCCTAGGCTACGGCAGCGAAA
>probe:Drosophila_2:1632226_at:10:347; Interrogation_Position=1364; Antisense; GCAGCGAAACTCTCGGGATAGCCGA
>probe:Drosophila_2:1632226_at:150:675; Interrogation_Position=1382; Antisense; TAGCCGAGATTGATTAAGCCCCAAA
>probe:Drosophila_2:1632226_at:375:683; Interrogation_Position=1521; Antisense; TATGCCTTAAATTCTGTTGACTAGC
>probe:Drosophila_2:1632226_at:523:79; Interrogation_Position=1554; Antisense; AGGTATTTCTATTTTGTGGCACAGA

Paste this into a BLAST search page for me
GAGTCTCCCGATGGACAGTGTTAAATGGAACTTCCCATCAGGTGTCTTGAGGTGTCTTGATTGCAATTGCACTGCCCAACGGACATGGAGCGGCTTATTAGAATCGGTTCAAAGCGTTCGGCGATGTAGAAATAGCTCCCAAAGCACCTTATATTTGGTCACTAACGCGACTCGATAACGCGACTCGAACTCGGAACTTCTCGAAGCGAAGGTCGCACTCTCTAATAACCCCTAGGCTACGGCAGCGAAAGCAGCGAAACTCTCGGGATAGCCGATAGCCGAGATTGATTAAGCCCCAAATATGCCTTAAATTCTGTTGACTAGCAGGTATTTCTATTTTGTGGCACAGA

Full Affymetrix probeset data:

Annotations for 1632226_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720