FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632227_at:

>probe:Drosophila_2:1632227_at:79:323; Interrogation_Position=462; Antisense; GCGCTGGTCAAGGTGGGTTCCAAAT
>probe:Drosophila_2:1632227_at:574:285; Interrogation_Position=463; Antisense; CGCTGGTCAAGGTGGGTTCCAAATG
>probe:Drosophila_2:1632227_at:527:537; Interrogation_Position=477; Antisense; GGTTCCAAATGGGTTTCCGCGATTG
>probe:Drosophila_2:1632227_at:46:463; Interrogation_Position=478; Antisense; GTTCCAAATGGGTTTCCGCGATTGT
>probe:Drosophila_2:1632227_at:260:629; Interrogation_Position=480; Antisense; TCCAAATGGGTTTCCGCGATTGTGT
>probe:Drosophila_2:1632227_at:78:311; Interrogation_Position=481; Antisense; CCAAATGGGTTTCCGCGATTGTGTC
>probe:Drosophila_2:1632227_at:130:65; Interrogation_Position=485; Antisense; ATGGGTTTCCGCGATTGTGTCACTA
>probe:Drosophila_2:1632227_at:418:593; Interrogation_Position=486; Antisense; TGGGTTTCCGCGATTGTGTCACTAA
>probe:Drosophila_2:1632227_at:440:539; Interrogation_Position=488; Antisense; GGTTTCCGCGATTGTGTCACTAATG
>probe:Drosophila_2:1632227_at:341:475; Interrogation_Position=489; Antisense; GTTTCCGCGATTGTGTCACTAATGG
>probe:Drosophila_2:1632227_at:485:633; Interrogation_Position=492; Antisense; TCCGCGATTGTGTCACTAATGGGAA
>probe:Drosophila_2:1632227_at:22:467; Interrogation_Position=497; Antisense; GATTGTGTCACTAATGGGAATTCCA
>probe:Drosophila_2:1632227_at:230:63; Interrogation_Position=510; Antisense; ATGGGAATTCCATAGGTGCGGCTGT
>probe:Drosophila_2:1632227_at:436:565; Interrogation_Position=513; Antisense; GGAATTCCATAGGTGCGGCTGTGTC

Paste this into a BLAST search page for me
GCGCTGGTCAAGGTGGGTTCCAAATCGCTGGTCAAGGTGGGTTCCAAATGGGTTCCAAATGGGTTTCCGCGATTGGTTCCAAATGGGTTTCCGCGATTGTTCCAAATGGGTTTCCGCGATTGTGTCCAAATGGGTTTCCGCGATTGTGTCATGGGTTTCCGCGATTGTGTCACTATGGGTTTCCGCGATTGTGTCACTAAGGTTTCCGCGATTGTGTCACTAATGGTTTCCGCGATTGTGTCACTAATGGTCCGCGATTGTGTCACTAATGGGAAGATTGTGTCACTAATGGGAATTCCAATGGGAATTCCATAGGTGCGGCTGTGGAATTCCATAGGTGCGGCTGTGTC

Full Affymetrix probeset data:

Annotations for 1632227_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720