FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632228_at:

>probe:Drosophila_2:1632228_at:579:235; Interrogation_Position=1000; Antisense; AATCCCTACTGGCTAGCTGTCAAAG
>probe:Drosophila_2:1632228_at:115:3; Interrogation_Position=1044; Antisense; ATTGAAGGTTCATCCCATCGTTTGT
>probe:Drosophila_2:1632228_at:436:143; Interrogation_Position=1078; Antisense; ACTGACAGTCGTTTCATTCGGGAGA
>probe:Drosophila_2:1632228_at:485:371; Interrogation_Position=1101; Antisense; GAAGGGTACCCCAGCCATTGGATTC
>probe:Drosophila_2:1632228_at:88:543; Interrogation_Position=1120; Antisense; GGATTCTCACCCATTATAAACACCA
>probe:Drosophila_2:1632228_at:102:51; Interrogation_Position=1147; Antisense; ATGCGGATCCATGACCACGACGAGT
>probe:Drosophila_2:1632228_at:145:261; Interrogation_Position=1162; Antisense; CACGACGAGTTTCTGCAGGCTGATG
>probe:Drosophila_2:1632228_at:110:385; Interrogation_Position=1257; Antisense; GAACTACATGGATCGTGGCTATAAT
>probe:Drosophila_2:1632228_at:534:179; Interrogation_Position=709; Antisense; AACAAACTGACTGAATTCCGCACCT
>probe:Drosophila_2:1632228_at:95:247; Interrogation_Position=722; Antisense; AATTCCGCACCTCGCAAGTGGAGAA
>probe:Drosophila_2:1632228_at:152:109; Interrogation_Position=743; Antisense; AGAACCTTGCGAGAGATTCCAGCCT
>probe:Drosophila_2:1632228_at:670:221; Interrogation_Position=772; Antisense; AAGGGCGATGTGACCACCGTGAATC
>probe:Drosophila_2:1632228_at:283:537; Interrogation_Position=852; Antisense; GGTCTTCGACATACGGATTGCCATT
>probe:Drosophila_2:1632228_at:61:555; Interrogation_Position=963; Antisense; GGAGCCTTATATAGGACCCACCAAG

Paste this into a BLAST search page for me
AATCCCTACTGGCTAGCTGTCAAAGATTGAAGGTTCATCCCATCGTTTGTACTGACAGTCGTTTCATTCGGGAGAGAAGGGTACCCCAGCCATTGGATTCGGATTCTCACCCATTATAAACACCAATGCGGATCCATGACCACGACGAGTCACGACGAGTTTCTGCAGGCTGATGGAACTACATGGATCGTGGCTATAATAACAAACTGACTGAATTCCGCACCTAATTCCGCACCTCGCAAGTGGAGAAAGAACCTTGCGAGAGATTCCAGCCTAAGGGCGATGTGACCACCGTGAATCGGTCTTCGACATACGGATTGCCATTGGAGCCTTATATAGGACCCACCAAG

Full Affymetrix probeset data:

Annotations for 1632228_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720