Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632233_at:

>probe:Drosophila_2:1632233_at:512:347; Interrogation_Position=1746; Antisense; GCAGGGACAGACTCCGGAGCAGTAT
>probe:Drosophila_2:1632233_at:590:413; Interrogation_Position=1776; Antisense; GACCATAGGCTATCGGCTGACGGAT
>probe:Drosophila_2:1632233_at:637:551; Interrogation_Position=1821; Antisense; GGACATTTACCTTAAGCGTCAAACG
>probe:Drosophila_2:1632233_at:645:571; Interrogation_Position=1856; Antisense; GGCTCTACGCAGCTGTGATCATTAG
>probe:Drosophila_2:1632233_at:478:555; Interrogation_Position=1900; Antisense; GGACCGGATGAATGCTTCGAGCTGA
>probe:Drosophila_2:1632233_at:47:83; Interrogation_Position=1928; Antisense; AGGGATGGCTCTGGCTAGCGCACAT
>probe:Drosophila_2:1632233_at:359:535; Interrogation_Position=1953; Antisense; GGTGCATGTGAAACCATTGCCCGAT
>probe:Drosophila_2:1632233_at:209:9; Interrogation_Position=1968; Antisense; ATTGCCCGATATTAGTGCTACCTTG
>probe:Drosophila_2:1632233_at:39:639; Interrogation_Position=2015; Antisense; TCGGCTTCGAGTTGTGGCGCACCTA
>probe:Drosophila_2:1632233_at:9:355; Interrogation_Position=2033; Antisense; GCACCTACGGCAAGCAGTTCGTCAA
>probe:Drosophila_2:1632233_at:685:493; Interrogation_Position=2053; Antisense; GTCAAGCTGCTGGTCTACATTCAGA
>probe:Drosophila_2:1632233_at:607:109; Interrogation_Position=2075; Antisense; AGAATATCTACATGCCTCAGCTGGC
>probe:Drosophila_2:1632233_at:644:331; Interrogation_Position=2130; Antisense; GCTGGAAATGCTCCTGGCCAAGTTC
>probe:Drosophila_2:1632233_at:386:429; Interrogation_Position=2186; Antisense; GAGTTTTGCCTCCAGGATTTTGGTA

Paste this into a BLAST search page for me
GCAGGGACAGACTCCGGAGCAGTATGACCATAGGCTATCGGCTGACGGATGGACATTTACCTTAAGCGTCAAACGGGCTCTACGCAGCTGTGATCATTAGGGACCGGATGAATGCTTCGAGCTGAAGGGATGGCTCTGGCTAGCGCACATGGTGCATGTGAAACCATTGCCCGATATTGCCCGATATTAGTGCTACCTTGTCGGCTTCGAGTTGTGGCGCACCTAGCACCTACGGCAAGCAGTTCGTCAAGTCAAGCTGCTGGTCTACATTCAGAAGAATATCTACATGCCTCAGCTGGCGCTGGAAATGCTCCTGGCCAAGTTCGAGTTTTGCCTCCAGGATTTTGGTA

Full Affymetrix probeset data:

Annotations for 1632233_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime