FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632234_at:

>probe:Drosophila_2:1632234_at:366:223; Interrogation_Position=1181; Antisense; AAGGTCGTCGAGGTGGCCCGTCATC
>probe:Drosophila_2:1632234_at:592:447; Interrogation_Position=1208; Antisense; GATGCCGATACTCTATATGTGCTGA
>probe:Drosophila_2:1632234_at:640:453; Interrogation_Position=1234; Antisense; GATAGACTTGGCTGAGGCGCAACCC
>probe:Drosophila_2:1632234_at:577:437; Interrogation_Position=1247; Antisense; GAGGCGCAACCCAGAACGATTATTA
>probe:Drosophila_2:1632234_at:373:199; Interrogation_Position=1307; Antisense; AACCAGCGATTGGTGGCGGTTCTTT
>probe:Drosophila_2:1632234_at:730:689; Interrogation_Position=1329; Antisense; TTTGCAACCTGAAGCCGTCCAAGAT
>probe:Drosophila_2:1632234_at:441:51; Interrogation_Position=1352; Antisense; ATGCGCGGCATCTTGTCCGAGGGCA
>probe:Drosophila_2:1632234_at:129:83; Interrogation_Position=1371; Antisense; AGGGCATGGTTCTGTGCACCTCCAA
>probe:Drosophila_2:1632234_at:85:593; Interrogation_Position=1410; Antisense; TGGTGGAGCCTATTGTGCTGCCAGC
>probe:Drosophila_2:1632234_at:16:585; Interrogation_Position=1477; Antisense; TGGCACGCCCGATGAGCAGCTTAAT
>probe:Drosophila_2:1632234_at:466:407; Interrogation_Position=1557; Antisense; GACTGGCCGTGTGGAAGGACAACTT
>probe:Drosophila_2:1632234_at:700:331; Interrogation_Position=1618; Antisense; GCTGGCCAACTGCTCCATTAAATAA
>probe:Drosophila_2:1632234_at:297:257; Interrogation_Position=1658; Antisense; CCTACCTGAGCCGTGTAATACTTAC
>probe:Drosophila_2:1632234_at:229:339; Interrogation_Position=1717; Antisense; GCTAATTTATTGATTCCTCTTCGTA

Paste this into a BLAST search page for me
AAGGTCGTCGAGGTGGCCCGTCATCGATGCCGATACTCTATATGTGCTGAGATAGACTTGGCTGAGGCGCAACCCGAGGCGCAACCCAGAACGATTATTAAACCAGCGATTGGTGGCGGTTCTTTTTTGCAACCTGAAGCCGTCCAAGATATGCGCGGCATCTTGTCCGAGGGCAAGGGCATGGTTCTGTGCACCTCCAATGGTGGAGCCTATTGTGCTGCCAGCTGGCACGCCCGATGAGCAGCTTAATGACTGGCCGTGTGGAAGGACAACTTGCTGGCCAACTGCTCCATTAAATAACCTACCTGAGCCGTGTAATACTTACGCTAATTTATTGATTCCTCTTCGTA

Full Affymetrix probeset data:

Annotations for 1632234_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720