FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632235_at:

>probe:Drosophila_2:1632235_at:221:631; Interrogation_Position=1270; Antisense; TCCTCCGGAGCCTGGATGTGGCAAA
>probe:Drosophila_2:1632235_at:266:183; Interrogation_Position=1292; Antisense; AAAACGCCTGCAGGATTCGCTTCTG
>probe:Drosophila_2:1632235_at:592:463; Interrogation_Position=1305; Antisense; GATTCGCTTCTGCAGCTGTCAGAGC
>probe:Drosophila_2:1632235_at:699:431; Interrogation_Position=1347; Antisense; GAGTGCAATCACTTCCACTTGGTGG
>probe:Drosophila_2:1632235_at:77:295; Interrogation_Position=1373; Antisense; CGACACAACGATGGCGGCTCTGCAT
>probe:Drosophila_2:1632235_at:322:51; Interrogation_Position=1396; Antisense; ATGCGGCCAACAACTTCTTCGAGAG
>probe:Drosophila_2:1632235_at:310:129; Interrogation_Position=1462; Antisense; ACCAGGCCCGTTTGGAGACCATAAT
>probe:Drosophila_2:1632235_at:547:307; Interrogation_Position=1489; Antisense; CCATGACAATGGACGCGTTGCGGCT
>probe:Drosophila_2:1632235_at:176:569; Interrogation_Position=1518; Antisense; GGCATTGTGTTGCAGCCCATAATTC
>probe:Drosophila_2:1632235_at:546:311; Interrogation_Position=1551; Antisense; GCCAACCGGCTGCTCGATAAGCTGA
>probe:Drosophila_2:1632235_at:574:459; Interrogation_Position=1605; Antisense; TACTTGGCCGAGAGTTTTGCCACCA
>probe:Drosophila_2:1632235_at:362:3; Interrogation_Position=1676; Antisense; ATTGGACGGGCAAACCAGTGCGCTG
>probe:Drosophila_2:1632235_at:718:415; Interrogation_Position=1791; Antisense; GAGCGCCGCGAAACAATGTCCTGAA
>probe:Drosophila_2:1632235_at:159:251; Interrogation_Position=1804; Antisense; CAATGTCCTGAAGTGGCCGTAATAA

Paste this into a BLAST search page for me
TCCTCCGGAGCCTGGATGTGGCAAAAAAACGCCTGCAGGATTCGCTTCTGGATTCGCTTCTGCAGCTGTCAGAGCGAGTGCAATCACTTCCACTTGGTGGCGACACAACGATGGCGGCTCTGCATATGCGGCCAACAACTTCTTCGAGAGACCAGGCCCGTTTGGAGACCATAATCCATGACAATGGACGCGTTGCGGCTGGCATTGTGTTGCAGCCCATAATTCGCCAACCGGCTGCTCGATAAGCTGATACTTGGCCGAGAGTTTTGCCACCAATTGGACGGGCAAACCAGTGCGCTGGAGCGCCGCGAAACAATGTCCTGAACAATGTCCTGAAGTGGCCGTAATAA

Full Affymetrix probeset data:

Annotations for 1632235_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720