FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632236_at:

>probe:Drosophila_2:1632236_at:119:549; Interrogation_Position=2561; Antisense; GGAGTCACCTTACAGGTTCATCTTC
>probe:Drosophila_2:1632236_at:157:7; Interrogation_Position=2601; Antisense; ATTGCTGCCAATTGGGACTTGTACA
>probe:Drosophila_2:1632236_at:474:603; Interrogation_Position=2626; Antisense; TGATTACCGTTCTAACTCTACTGCT
>probe:Drosophila_2:1632236_at:498:659; Interrogation_Position=2638; Antisense; TAACTCTACTGCTGGGCATCATCAT
>probe:Drosophila_2:1632236_at:32:491; Interrogation_Position=2663; Antisense; GTACATGAGGCGTCCATTTCAGCAG
>probe:Drosophila_2:1632236_at:720:55; Interrogation_Position=2719; Antisense; ATGACATTGCTGCTGCGCCAGTTAA
>probe:Drosophila_2:1632236_at:331:131; Interrogation_Position=2771; Antisense; ACCTGTAGCCGCAGTGGTCGAAGGT
>probe:Drosophila_2:1632236_at:89:93; Interrogation_Position=2822; Antisense; AGTTTCATCTCACGATGCTGTGGCC
>probe:Drosophila_2:1632236_at:434:503; Interrogation_Position=2885; Antisense; GTCCCTTGTCGATGCAGCGTCACAA
>probe:Drosophila_2:1632236_at:359:221; Interrogation_Position=2915; Antisense; AAGTGGCACGACATCTGCGGCGCCG
>probe:Drosophila_2:1632236_at:496:317; Interrogation_Position=2936; Antisense; GCCGGATGGCGCTAACACACTCGAT
>probe:Drosophila_2:1632236_at:4:295; Interrogation_Position=2957; Antisense; CGATCCCACTGGTTAGTCTTAGTAA
>probe:Drosophila_2:1632236_at:126:149; Interrogation_Position=2981; Antisense; ACTTGGTAAATCATCCCTCTAGGTT
>probe:Drosophila_2:1632236_at:48:689; Interrogation_Position=3024; Antisense; TATTTATCATCTAATTTCGCCCGAT

Paste this into a BLAST search page for me
GGAGTCACCTTACAGGTTCATCTTCATTGCTGCCAATTGGGACTTGTACATGATTACCGTTCTAACTCTACTGCTTAACTCTACTGCTGGGCATCATCATGTACATGAGGCGTCCATTTCAGCAGATGACATTGCTGCTGCGCCAGTTAAACCTGTAGCCGCAGTGGTCGAAGGTAGTTTCATCTCACGATGCTGTGGCCGTCCCTTGTCGATGCAGCGTCACAAAAGTGGCACGACATCTGCGGCGCCGGCCGGATGGCGCTAACACACTCGATCGATCCCACTGGTTAGTCTTAGTAAACTTGGTAAATCATCCCTCTAGGTTTATTTATCATCTAATTTCGCCCGAT

Full Affymetrix probeset data:

Annotations for 1632236_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720