FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632237_at:

>probe:Drosophila_2:1632237_at:567:261; Interrogation_Position=2671; Antisense; CAGCGGTCCGGATGTCTGCATGTCG
>probe:Drosophila_2:1632237_at:215:719; Interrogation_Position=2712; Antisense; TTGGCAATGCCGATTCCAATGGCGA
>probe:Drosophila_2:1632237_at:536:249; Interrogation_Position=2728; Antisense; CAATGGCGATGGACGCGACCTGAGC
>probe:Drosophila_2:1632237_at:222:109; Interrogation_Position=2780; Antisense; AGCAATCCCGGCAGTAGTCTGGACA
>probe:Drosophila_2:1632237_at:379:91; Interrogation_Position=2792; Antisense; AGTAGTCTGGACAAGTGCGCGGCCA
>probe:Drosophila_2:1632237_at:288:125; Interrogation_Position=2816; Antisense; AGCGCCAACATAGAGCTGCTCGATG
>probe:Drosophila_2:1632237_at:496:405; Interrogation_Position=2875; Antisense; GACTGGCAAGGGTTCGAGCACACCG
>probe:Drosophila_2:1632237_at:311:377; Interrogation_Position=2913; Antisense; GAAGCAACTCGATCGCCACGCTGAG
>probe:Drosophila_2:1632237_at:551:229; Interrogation_Position=2977; Antisense; AATGGTATCCATTGTCTAGCGCCAG
>probe:Drosophila_2:1632237_at:157:125; Interrogation_Position=2994; Antisense; AGCGCCAGTCGGTTCCTAGCTAAGT
>probe:Drosophila_2:1632237_at:571:275; Interrogation_Position=3009; Antisense; CTAGCTAAGTGCACCTCCAATTGAA
>probe:Drosophila_2:1632237_at:341:3; Interrogation_Position=3028; Antisense; ATTGAAAACAGTTCCCAGTCCCTTG
>probe:Drosophila_2:1632237_at:716:483; Interrogation_Position=3052; Antisense; GTATCGCGTCATTTAGGTGTGTTCT
>probe:Drosophila_2:1632237_at:71:441; Interrogation_Position=3128; Antisense; GATGGTAAACTCAACGTGTGCAAAG

Paste this into a BLAST search page for me
CAGCGGTCCGGATGTCTGCATGTCGTTGGCAATGCCGATTCCAATGGCGACAATGGCGATGGACGCGACCTGAGCAGCAATCCCGGCAGTAGTCTGGACAAGTAGTCTGGACAAGTGCGCGGCCAAGCGCCAACATAGAGCTGCTCGATGGACTGGCAAGGGTTCGAGCACACCGGAAGCAACTCGATCGCCACGCTGAGAATGGTATCCATTGTCTAGCGCCAGAGCGCCAGTCGGTTCCTAGCTAAGTCTAGCTAAGTGCACCTCCAATTGAAATTGAAAACAGTTCCCAGTCCCTTGGTATCGCGTCATTTAGGTGTGTTCTGATGGTAAACTCAACGTGTGCAAAG

Full Affymetrix probeset data:

Annotations for 1632237_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720