FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632238_at:

>probe:Drosophila_2:1632238_at:260:147; Interrogation_Position=2321; Antisense; ACTACTTCAATTGGTTACTGTTCTT
>probe:Drosophila_2:1632238_at:226:247; Interrogation_Position=2328; Antisense; CAATTGGTTACTGTTCTTTTGAGAA
>probe:Drosophila_2:1632238_at:541:141; Interrogation_Position=2459; Antisense; ACTGATACTGTTTAAAGTCCTGTAC
>probe:Drosophila_2:1632238_at:431:87; Interrogation_Position=2474; Antisense; AGTCCTGTACTTAAAGCATCTCTAT
>probe:Drosophila_2:1632238_at:217:605; Interrogation_Position=2527; Antisense; TGCATTCCAAAAACCCAACGTTGAA
>probe:Drosophila_2:1632238_at:158:161; Interrogation_Position=2537; Antisense; AAACCCAACGTTGAACGAGACATAT
>probe:Drosophila_2:1632238_at:420:151; Interrogation_Position=2581; Antisense; ACATATTGTGGCGAAGTACCTTATA
>probe:Drosophila_2:1632238_at:168:519; Interrogation_Position=2588; Antisense; GTGGCGAAGTACCTTATATTATATA
>probe:Drosophila_2:1632238_at:266:251; Interrogation_Position=2623; Antisense; CAAGGTATAGCTATTTACAGTGTAT
>probe:Drosophila_2:1632238_at:645:23; Interrogation_Position=2659; Antisense; ATATCGCAGAAATGGTATTACACAC
>probe:Drosophila_2:1632238_at:88:483; Interrogation_Position=2694; Antisense; GTATTTACTCTGCAAACGTACAAAT
>probe:Drosophila_2:1632238_at:647:701; Interrogation_Position=2723; Antisense; TTATTTAACGTTATGCACACATGGC
>probe:Drosophila_2:1632238_at:222:357; Interrogation_Position=2737; Antisense; GCACACATGGCATTTGTTAAACTAT
>probe:Drosophila_2:1632238_at:49:27; Interrogation_Position=2763; Antisense; ATAGTACACACATACATGTCTTTAA

Paste this into a BLAST search page for me
ACTACTTCAATTGGTTACTGTTCTTCAATTGGTTACTGTTCTTTTGAGAAACTGATACTGTTTAAAGTCCTGTACAGTCCTGTACTTAAAGCATCTCTATTGCATTCCAAAAACCCAACGTTGAAAAACCCAACGTTGAACGAGACATATACATATTGTGGCGAAGTACCTTATAGTGGCGAAGTACCTTATATTATATACAAGGTATAGCTATTTACAGTGTATATATCGCAGAAATGGTATTACACACGTATTTACTCTGCAAACGTACAAATTTATTTAACGTTATGCACACATGGCGCACACATGGCATTTGTTAAACTATATAGTACACACATACATGTCTTTAA

Full Affymetrix probeset data:

Annotations for 1632238_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720