FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632239_at:

>probe:Drosophila_2:1632239_at:328:661; Interrogation_Position=129; Antisense; TAGGAAAAGCCTCAACTTGCCTGCG
>probe:Drosophila_2:1632239_at:373:353; Interrogation_Position=153; Antisense; GCACCGGAAATTCAACTTTGCCGAA
>probe:Drosophila_2:1632239_at:11:609; Interrogation_Position=197; Antisense; TGAGCTCGGGTGGTGTAGCCAATAC
>probe:Drosophila_2:1632239_at:107:433; Interrogation_Position=262; Antisense; GAGTGCAACTTCATAGGCTGTGGCT
>probe:Drosophila_2:1632239_at:594:573; Interrogation_Position=277; Antisense; GGCTGTGGCTACATCGAAATCGATC
>probe:Drosophila_2:1632239_at:530:589; Interrogation_Position=314; Antisense; TGGATCTGGCCAACATTCGCACCAA
>probe:Drosophila_2:1632239_at:308:673; Interrogation_Position=377; Antisense; TACCATTCCTGGTGGATGCGTATCG
>probe:Drosophila_2:1632239_at:676:393; Interrogation_Position=402; Antisense; GAAATGCGAGCTATTCCGATCGTCG
>probe:Drosophila_2:1632239_at:538:501; Interrogation_Position=423; Antisense; GTCGCACGGAAGACGATTCACTCTC
>probe:Drosophila_2:1632239_at:539:1; Interrogation_Position=460; Antisense; ATTGAATTCATCGAGGAACCCTGCA
>probe:Drosophila_2:1632239_at:233:709; Interrogation_Position=496; Antisense; TTACAAATCACCATATGCGTCCGCA
>probe:Drosophila_2:1632239_at:462:49; Interrogation_Position=524; Antisense; ATGCCATGCAAAAGTGTCCCAGCGA
>probe:Drosophila_2:1632239_at:629:139; Interrogation_Position=554; Antisense; ACGTGGACAGCGACGAGTGCCGATT
>probe:Drosophila_2:1632239_at:100:505; Interrogation_Position=570; Antisense; GTGCCGATTGGCCAGGGAATACTTC

Paste this into a BLAST search page for me
TAGGAAAAGCCTCAACTTGCCTGCGGCACCGGAAATTCAACTTTGCCGAATGAGCTCGGGTGGTGTAGCCAATACGAGTGCAACTTCATAGGCTGTGGCTGGCTGTGGCTACATCGAAATCGATCTGGATCTGGCCAACATTCGCACCAATACCATTCCTGGTGGATGCGTATCGGAAATGCGAGCTATTCCGATCGTCGGTCGCACGGAAGACGATTCACTCTCATTGAATTCATCGAGGAACCCTGCATTACAAATCACCATATGCGTCCGCAATGCCATGCAAAAGTGTCCCAGCGAACGTGGACAGCGACGAGTGCCGATTGTGCCGATTGGCCAGGGAATACTTC

Full Affymetrix probeset data:

Annotations for 1632239_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720